This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How To Retrieve Fasta Sequences By Gene Symbols In Multiple Query?

Hi all,

I have a set of 500 orf:

NMB0001 NMB0002 NMB0010 ... ..

I have to obtain the corresponding fasta nucleotide sequences of those orf. Doing it manually wouold be too much time and energy spending. Is there any fast and automatic way to obtain the fasta sequences given the Symbol as ID's?

Thanks a lot in advance for your help

Giorgio

data
• 15,547 views • link
updated by Maximilian Haeussler Maximilian Haeussler • written by giorgiocasaburi85 • giorgiocasaburi85

programmatically (e.g. BioPerl/Biomart) or with a user interface (e.g. UCSC table browser/Biomart)?

• 0 views • link
written by Irsan Irsan

I know it could be done programmatically..is for that reason I wrote the post since I don't know how to do it! :/

• 0 views • link
written by giorgiocasaburi85 • giorgiocasaburi85

6 answers

This can be done in two steps:

  1. At the NCBI, see the complete chromosome sequence of Neisseria meningitidis: http://www.ncbi.nlm.nih.gov/nuccore/NC_003112.2
  2. Send -> File -> Coding Sequences

You will get the multiple FASTA file containing coding sequences of all Neisseria genes (NB0001, NB0002, etc.). See below:

>lcl|NC_003112.2_cdsid_NP_273067.1 [gene=NMB0001] [protein=acetyltransferase] [protein_id=NP_273067.1] [location=complement(7..498)]
ATGAATTCCCTCTTTGTGGACAATACTGTTTTCATTACACGGCTGAAAGCCGGGCATATCGGCAGGTTGG
TTCAGGCGTTGTTTGAGGAGTGGCACGGATTTGAACCGTGGTCTTCTGTGGATAAGATTCATGCCTATTA
CGGCAGGTGTTTGAAGGATGACGAACTGCCGCTGGCATTTGCGGCTGTGGATGATTCCGGAATCCTGTTG
GGTTCGGCTGCGGTCAAGCGGCATGATATGGAAAGTTTTCCACGGTATGAATATTGGTTGGGGGATGTCT
TTGTTTTACCTGAATATCGCGGAAAAGGCATTGGCAGGAGGCTGGTCGCCCACTGCATAGGCGCAGCGCG
TTCGCTGGGGATAAAGTTCTTGTATCTTTATACGCCTGATGTGCAAATATTTTATGAATCATTCGGCTGG
GTGGTTGTCGGGCGACATTTCCATAACGGTGAATGGGTTACGGTTATGCGTTTGGATGTGGATAAGGTTT
AA
>lcl|NC_003112.2_cdsid_NP_273068.1 [gene=NMB0002] [protein=hypothetical protein] [protein_id=NP_273068.1] [location=complement(502..897)]
ATGCCGTCTGATGTCGGAATACGGCTTCAGACAGCATTTAAATGGAAGTTAAAAATGAAAAAAATATTTT
ATTTTCTGATGGTTGTTTTTTCTACAAGCGTATGGGCAGGGGATGCTGAAGACAATCTGCTCAGCATCCA
ATCCGGTTACCGCGCCTTATTGCAAAAGCAAAACAATCTGGACGGAAAAATCATCGGGATGCAGTCGGAT
TTGGAAGATGCGCGCCGGCGTTTGCAGACGGCTCAGGCAGACATCGCCCGTTTGGAAGCGGAAATTCCTG
CAGCAATGGCGCAAAAAGCCCGGCAGGCTGAAGATTTGAGGCAAATCGGAGTGCGTTTGGACCATGCTTG
GAATGCGGTTTACGGCGCAGGGGGAACGAAGGCGTCGGGGAATTGA
[...]
• 356 views • link
written by Andrzej Zielezinski Andrzej Zielezinski

There are many ways, one of them is:

  • Go to ensembl biomart interface
  • Choose database --> Ensembl genes
  • Choose dataset --> homo sapiens genes
  • click filters
  • click genes
  • at ID list limit choose your preferred identifyer and paste a list of IDs where each ID is on a different line (I think you can copy paste from an Excel column)
  • click attributes
  • choose sequences
  • click +sign at sequences
  • choose unspliced gene
  • click results

Done ... :-)

• 0 views • link
written by Irsan Irsan

Thank you for your answer; unfortunately these genes are not human. They are from a bacteria (Neisseria Meningitidis). So the ensemble way I think it's not applicable.

• 0 views • link
written by giorgiocasaburi85 • giorgiocasaburi85

Then again, there are many ways but you need to have the genome sequence of Neisseria Meningitidis and locations of the genes in that genome in order to extract the DNA sequence. I suggest you make a bed-file with the gene locations, download the Neisseria Meningitidis genome sequence and have a look at Batch Fetching Fasta Sequences From Bed File to extract DNA sequences based on your bed file.

• 0 views • link
written by Irsan Irsan

oh ok, I'll try that way. Thanks!

• 0 views • link
written by giorgiocasaburi85 • giorgiocasaburi85

BTW, this is not an answer but a comment, you can change it ... :-) same for your other comment above

• 0 views • link
written by Irsan Irsan

Also I found this: http://biit.cs.ut.ee/gprofiler/gconvert.cgi ; It's very good for ID's conversion and it's not limited only to 2-3 genomes.

• 0 views • link
written by giorgiocasaburi85 • giorgiocasaburi85

Use the UCSC Table Browser http://genome.ucsc.edu/cgi-bin/hgTables

Select a genome and gene track

Under output, select sequence.

Click "get output". Select "genomic sequence". Select "CDS"

• 0 views • link
written by Maximilian Haeussler Maximilian Haeussler

Log in to answer this question.

More posts like this