This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Samtools Tview Iupac

I wonder why there are K in the first line. It seems that the K doesnt mean G/T here, because only one read mapped in the position, and there are not mismatch in this read.

Could anyone help me? thanks

enter image description here

samtools
• 2,495 views • link
written by sunhanice sunhanice

Can you show us the SAM record of that read please.

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

the read in the sam file is :

SRR040290.11836137 0 chr2 10263590 255 48M * 0 0 CCATCGAGTACCATGATATCTGGCAGATGTATAAGAAGGCAGAGGCTT WQPX_][\VRY[SKOM;=KMOGCDJO29PQ:!!4NB605DJG8+!!!! XA:i:1 MD:Z:48 NM:i:0 CM:i:8

• 0 views • link
written by sunhanice sunhanice

but this raw read in the fastq file is T20013232213101312333221031222113222220203122202023, if I convert it to atcg, I can get CCCATCGAGTACCATGATATCTGGCAGAGTGCTCTCTTCCGTCTCCTTCG, it seems that the only first part of this read(CCCATCGAGTACCATGATATCTGGCAGA) is the same as the reference, is it soft clipped mapped?

• 0 views • link
written by sunhanice sunhanice

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Fastqc, Trimming And Kmers
    written by int11ap1 int11ap1
    <p>Good morning everybody,</p> <p>I had RNA-seq data from Illumina (paired-ends), which adapters were removed and quality trimming performed successfully using Trimmomatic. After analysing with FastQC, …
  • Is There Any Software That Can Be Used To Draw A Gene Order Figure?
    written by Cacau Cacau
    <p>Is there any software that can be used to draw a gene order figure like this one<img src='http://www.pnas.org/content/104/35/13948/F5.large.jpg' alt='enter image description here' /></p> <p>or this …
  • Are There Some Nextera Barcodes / Adaptors Left?
    written by mazzottidr • mazzottidr
    <p>Dear all, I've just got some Illumina exome data from MiSeq (Nextera capture) and got the following fastqc results. Would someone give feedback on what …
  • Count 5'End Mapped To A Specific Genomic Position
    written by ifreecell ifreecell
    <p>I got several <a href='http://samtools.sourceforge.net/SAM1.pdf'>SAM</a>/BAM files, and I am interested in 5'ends of the mapped reads. Is there any tools or scripts to count how …
  • Rna-Seq P-Values
    written by siddharth.sethi5 siddharth.sethi5
    <p>Hi , </p> <p><img src='http://www.freeimagehosting.net/newuploads/wi76p.png' alt='geneA' /></p> <p><img src='http://www.freeimagehosting.net/newuploads/b76ty.png' alt='geneB' /></p> <p>Can anyone tell me why Dbp(geneA) has a high (&gt;0.05) p value and Prokr2(geneB) …
  • Sequence Identity : Nucleotide Resolution
    written by Nicolas Rosewick Nicolas Rosewick
    <p>Hi,</p> <p>It's a pretty simple question but I can not find any good answer on internet : How can I compute the identity between sequences …
  • Deseq, Edger And Cuffdiff - Different Result
    written by Nicolas Rosewick Nicolas Rosewick
    <p>Hi,</p> <p>I performed differential expression analysis with DESeq, edgeR and cuffdiff on my data. Surprisingly, there are differences between DESeq, edgeR and cuffdiff. Here's a …
  • How To Get "Alternate Gene Name" (Gene_Id) From Ucsc Table Browser?
    written by Dan D Dan D
    <p><strong>On the UCSC graphical genome browser, the "alternate gene names" are shown, like in the picture below:</strong></p> <p><img src="http://illumin-8.com/GeneNames.PNG" alt="enter image description here"/></p> <p><strong>If I …
  • Snv Substitution Pattern
    written by sunhanice sunhanice
    <p>In sequencing papers, there always are figures like this : <img src="http://www.freeimagehosting.net/newuploads/enx1h.png" alt="enter image description here"/></p> <p>What I don't understand is that ,why they only …
  • Substitution Per Mb
    written by sunhanice sunhanice
    <p><img src='http://www.freeimagehosting.net/t/3hzkg.jpg' alt='enter image description here' /></p> <p>In the sequencing papers, there always have the figure like above,</p> <p>I wonder what does 'per Mb' in …