This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Update Multiple Sequences From Fasta File And Write Them As A New Fasta In Biopython

Hi,

I have a set of sequences in a fasta file, i read them into biopython and then i want to make some changes to them (adding or replacing or deleting) and then i want to save them to a new fastafile.

what i'm doing in the example is a small shifting of 5 nucleotides : 

>     allrecords=list(SeqIO.parse("test.fasta", 'fasta'))
>             fullseq=0
>             tochangeseq =0 
>              oldfullseq=0     
> 
> for y in range(len(allrecords)):
> 
> 
>           oldfullseq=allrecords[y].seq
>             tochange=5        #might be dynamically included by another for loop
>             tochangeseq = allrecords[y].seq[0:tochange]
>             fullseq = oldfullseq[tochange:len(oldfullseq)]
>             fullseq += tochangeseq
>             allrecords[y].seq = fullseq
> print allrecords[0].seq    ### it should print the new updated sequence, but it's not

but the problem is when i print the sequences after the loop, i found that they did not changed, how can i update them and then write the new version to a fasta file.

help would be appreciated

biopython
• 5,725 views • link
updated by Biostar Biostar • written by Abdullah Abdullah

The code for the sequence manipulation is a bit convoluted. You can just do this:

newSeq = allrecords[y].seq[tochange:] + allrecords[y].seq[:tochange]

allrecords[y].seq = newSeq

But I don't see anything wrong with it. It looks like you deleted a lot of the code. Can you post the full code?

• 0 views • link
written by Damian Kao Damian Kao

Hi, when i try your method, i get Memory error .. besides .. that's the whole code .. i just want to update the sequences and output the new ones to a new fasta file .. but it's not working

• 0 views • link
written by Abdullah Abdullah

Just do this then:

tochange = 5
for record in SeqIO.parse('test.fasta','fasta')):
   seq = str(record.seq)
   print '>' + record.description
   print seq[tochange:] + seq[:tochange]

pipe the results to a new file.

• 0 views • link
written by Damian Kao Damian Kao

i think this not a good idea to do this .. i want to fill the new sequences inside an array because i might need them for other computational stuff ...the question is why my method is not working, if i print full seq it prints the new sequence but it's not being assigned to the record object ..

• 0 views • link
written by Abdullah Abdullah

Honestly I don't really know why it doesn't work for you. That's why I thought maybe you didn't post the full code. I tried this:

from Bio import SeqIO

allRecords = list(SeqIO.parse('test.fa','fasta'))

tochange = 5
for i in range(len(allRecords)):
    newSeq = allRecords[i].seq[tochange:] + '.' + allRecords[i].seq[:tochange]
    allRecords[i].seq = newSeq

print allRecords[0].seq
print allRecords[1].seq

On this test.fa:

>test1
AGTGCTAGCTAGCTATTATATGCGACTGATCGTACTGGTAGCTGGTCA
>test2
ACGATCGTAGTCTTGATGCTAGTTTATATGGTCGTAGTCAGTCGTACA

And it worked for me. Giving me this:

TAGCTAGCTATTATATGCGACTGATCGTACTGGTAGCTGGTCA.AGTGC
CGTAGTCTTGATGCTAGTTTATATGGTCGTAGTCAGTCGTACA.ACGAT
• 0 views • link
written by Damian Kao Damian Kao

It's not a good idea to work on large sequences (which I assume you are doing) and store them all in-memory. This is why Damian's previously suggested method resulted in a memory error for you.

On another note, I also tried your posted code with a smaller mock fasta file, it works just fine. It prints the new sequences, and when I inspected the SeqRecord objects, their sequences have changed as well. Have you posted the entire code?

• 0 views • link
written by bow bow

You forgot to open the 'test.fasta' file:) Try: allrecords = list(SeqIO.parse(open("test.fasta"), "fasta"))

• 0 views • link
written by Andrzej Zielezinski Andrzej Zielezinski

No, in modern Biopython, SeqIO.parse can take a filename as a string or a file handle

• 0 views • link
written by Ben Ben

Hi. I don't see the problem here. Your code works for me...

>>> allrecords[0].seq

Seq('GGAACGAGTTATCTGAACCTTCGGGGGACGATAACGGCGTCGAGCGGCGGACGG...AGC', SingleLetterAlphabet())

>>>for y in range(len(allrecords)):
    oldfullseq=allrecords[y].seq
    tochange=5    
    tochangeseq = allrecords[y].seq[0:tochange]
    fullseq = oldfullseq[tochange:len(oldfullseq)]
    fullseq += tochangeseq
    allrecords[y].seq = fullseq

.

>>>allrecords[0].seq

Seq('GAGTTATCTGAACCTTCGGGGGACGATAACGGCGTCGAGCGGCGGACGGGTGAG...AAC',SingleLetterAlphabet())

• 0 views • link
written by Manu Prestat Manu Prestat

Hi, thank you all for your help, i found the error .. it's working now .. and your codes also works ..

• 0 views • link
written by Abdullah Abdullah

0 answers

No answers yet.

Log in to answer this question.

More posts like this