Apologies for cross posting from StackExchange- perhaps this is the more appropriate venue. I'm trying to extract the sequence I need from a database using the following bioperl code:

use strict;
use Bio::SearchIO; 
use Bio::DB::Fasta;


my ($file, $id, $start, $end) = ("secondround_merged_expanded.fasta","C7136661:0-107",1,10);
my $db = Bio::DB::Fasta->new($file);
my $seq = $db->seq($id, $start, $end);
print $seq,"\n";

Where the header of the sequence I'm trying to extract is: C7136661:0-107, as in the file:

>C7047455:0-100
TATAATGCGAATATCGACATTCATTTGAACTGTTAAATCGGTAACATAAGCAGCACACCTGGGCAGATAGTAAAGGCATATGATAATAAGCTGGGGGCTA

The code extracts the appropriate sequence when the header and $id in above is changed to

>test
TATAATGCGAATATCGACATTCATTTGAACTGTTAAATCGGTAACATAAGCAGCACACCTGGGCAGATAGTAAAGGCATATGATAATAAGCTGGGGGCTA

I'm thinking that BioPerl doesn't like the heading with the colon. Any way to fix this so I don't have to recode the FASTA files?