This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How To Visualize Restriction Cutting Sites On Sequence?

I have restriction cutting sites for many restriction enzymes. I want to represent this sites diagrammatically. Which tool/software should I use to show this cutting sites on the sequence.

restriction-enzyme
• 5,752 views • link
updated by Ram Ram • written by BioInfo1010 • BioInfo1010

Hi

I want to do Virtual RFLP analysis on 16Sr DNAsequences from different isolates

Using the virtual gel plotting program pDRAW32 (AcaClone). actually I want to generate pattern of enzymatic restriction of all sequence with each one of restriction enzymes (AluI, BamHI, BfaI, BstUI, DraI,EcoRI, HaeIII, HhaI, HinfI, HpaI).

it is gratefully appreciated if you write me the path.

Sincerely yours

esmaeil

email: es_saberi@yahoo.com

• 0 views • link
updated by Ram Ram • written by es_saberi • es_saberi

2 answers

Hello, you could use pDRAW32 (freeware), Serial Cloner (freeware), ApE Plasmid Editor (freeware), VectorNTI, MacVector, depending on your preferences and on the OS you are working on. Personally, for what you ask I would simply use pDRAW32.

• 12 views • link
updated by Ram Ram • written by Anima Mundi Anima Mundi

Thank you very much.

Actually I have name of restriction enzyme and cutting sites in a text file. I want to visualize by diagrammatically on web page.

e.g.

EnzymeName        Cuttingposition
HindIII                    27,
HindIII                    42,
HindIII                    56,
HindIII                    73,
HindIII                    87,
EcoRI                    17,
EcoRI                    27,
EcoRI                    33,
EcoRI                    37,
EcoRI                    49,
......................................

like this many enzymes and their restriction cutting site. I want to visualize this on the sequence. is there any tool/software/java,perl script for visualize on web page.

Thank u again for your help.

• 0 views • link
updated by Ram Ram • written by BioInfo1010 • BioInfo1010

Ok, in that case I guess Matt provided the desired answer ;).

• 0 views • link
updated by Ram Ram • written by Anima Mundi Anima Mundi

I would suggest NEBcutter. It is a web-based tool from New England Biolabs, and will generate a map cut sites for your sequence and enzymes.

• 0 views • link
updated by Ram Ram • written by Matt Shirley Matt Shirley

Log in to answer this question.

More posts like this
  • Double Digest through Regular Expression in python
    written by anasjamshed anasjamshed
    I have the following DNA sequence in dna.txt file : ``` ATGGCAATAACCCCCCGTTTCTACTTCTAGAGGAGAAAAGTATTGACATGAGCGCTCCCGGCACAAGGGCCAAAGAAGTCTCCAATTTCTTATTTCCGAATGACATGCGTCTCCTTGCGGGTAAATCACCGACCGCAATTCATAGAAGCCTGGGGGAACAGATAGGTCTAATTAGCTTAAGAGAGTAAATCCTGGGATCATTCAGTAGTAACCATAAACTTACGCTGGGGCTTCTTCGGCGGATTTTTACAGTTACCAACCAGGAGATTTGAAGTAAATCAGTTGAGGATTTAGCCGCGCTATCCGGTAATCTCCAAATTAAAACATACCGTTCCATGAAGGCTAGAATTACTTACCGGCCTTTTCCATGCCTGCGCTATACCCCCCCACTCTCCCGCTTATCCGTCCGAGCGGAGGCAGTGCGATCCTCCGTTAAGATATTCTTACGTGTGACGTAGCTATGTATTTTGCAGAGCTGGCGAACGCGTTGAACACTTCACAGATGGTAGGGATTCGGGTAAAGGGCGTATAATTGGGGACTAACATAGGCGTAGACTACGATGGCGCCAACTCAATCGCAGCTCGAGCGCCCTGAATAACGTACTCATCTCAACTCATTCTCGGCAATCTACCGAGCGACTCGATTATCAACGGCTGTCTAGCAGTTCTAATCTTTTGCCAGCATCGTAATAGCCTCCAAGAGATTGATGATAGCTATCGGCACAGAACTGAGACGGCGCCGATGGATAGCGGACTTTCGGTCAACCACAATTCCCCACGGGACAGGTCCTGCGGTGCGCATCACTCTGAATGTACAAGCAACCCAAGTGGGCCGAGCCTGGACTCAGCTGGTTCCTGCGTGAGCTCGAGACTCGGGATGACAGCTCTTTAAACATAGAGCGGGGGCGTCGAACGGTCGAGAAAGTCATAGTACCTCGGGTACCAACTTACTCAGGTTATTGCTTGAAGCTGTACTATTTTAGGGGGGGAGCGCTGAAGGTCTCTTCTTCTCATGACTGAACTCGCGAGGGTCGTGAAGTCGGTTCCTTCAATGGTTAAAAAACAAAGGCTTACTGTGCGCAGAGGAACGCCCATCTAGCGGCTGGCGTCTTGAATGCTCGGTCCCCTTTGTCATTCCGGATTAATCCATTTCCCTCATTCACGAGCTTGCGAAGTCTACATTGGTATATGAATGCGACCTAGAAGAGGGCGCTTAAAATTGGCAGTGGTTGATGCTCTAAACTCCATTTGGTTTACTCGTGCATCACCGCGATAGGCTGACAAAGGTTTAACATTGAATAGCAAGGCACTTCCGGTCTCAATGAACGGCCGGGAAAGGTACGCGCGCGGTATGGGAGGATCAAGGGGCCAATAGAGAGGCTCCTCTCTCACTCGCTAGGAGGCAAATGTAAAACAATGGTTACTGCATCGATACATAAAACATGTCCATCGGTTGCCCAAAGTGTTAAGTGTCTATCACCCCTAGGGCCGTTTCCCGCATATAAACGCCAGGTTGTATCCGCATTTGATGCTACCGTGGATGAGTCTGCGTCGAGCGCGCCGCACGAATGTTGCAATGTATTGCATGAGTAGGGTTGACTAAGAGCCGTTAGATGCGTCGCTGTACTAATAGTTGTCGACAGACCGTCGAGATTAGAAAATGGTACCAGCATTTTCGGAGGTTCTCTAACTAGTATGGATTGCGGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAATCCAGCTGGTGTCAAGCCATCCCCTCTCCGGGACGCCGCATGTAGTGAAACATATACGTTGCACGGGTTCACCGCGGTCCGTTCTGAGTCGACCAAGGACACAATCGAGCTCCGATCCGTACCCTCGACAAACTTGTACCCGACCCCCGGAGCTTGCCAGCTCCTCGGGTATCATGGAGCCTGTGGTTCATCGCGTCCGATATCAAACTTCGTCATGATAAAGTCCCCCCCTCGGGAGTACCAGAGAAGATGACTACTGAGTTGTGCGAT ``` I want to read the DNA sequence from the file dna.txt and …
  • Can I use two restriction enzymes to analyze HiC data using HiCExplorer
    written by Yogendra Bordiya • Yogendra Bordiya
    Hi My HiC library was prepared using two restriction enzymes. The HiCExplorere tool findRestSites seems to take only one enzyme site as input. Is there …
  • Visualisation of restriction cutting sites using Biopython
    written by neilgupte7 • neilgupte7
    How to use GenomeDiagram class available in Biopython to map and show the restriction enzyme cutting sites ? The ouput should be close to snapgene …
  • Biopython restriction sites
    written by neilgupte7 • neilgupte7
    i want to access the site at which each restriction enzymes work and show the result in one file .Is there any way we can …
  • Finding restriction sites when the gene is on the negative strand
    written by c_u c_u
    Hi, This might be a naive question, but it has been troubling me for a bit. I have the human genome (hg19) cut by 2 …
  • Software to in silico test restriction enzymes for GBS sequencing and similar approaches
    written by Denis Denis
    Hi! We are planning some GBS sequencing experiment. We have the whole genome sequence of organism of interest. But we'd like to test in silico …
  • With Python, how can I solve this restriction mapping problem?
    written by francois • francois
    I'm struggling with the following Python project, which I'll call **multi-digest restriction mapping**. It is originally a bioinformatic problem, but you really do not need …
  • How to use fastools digest function to cut the positive strand of DNA exclusively?
    written by bright602 • bright602
    I am currently dealing with some fasta files using fastools to digest the sequence by MboI restriction enzyme. The command I used is as follow …
  • Identify restriction sites of a cDNA sequence using a dictionary
    written by albamaria.muniesa • albamaria.muniesa
    <p>Hi.</p> <p>I need to identify restriction sites of a cDNA sequence in a fasta file. First, I transform the sequence from FASTA to a string …
  • Chromosome Strand, Gene Direction, Restriction Enzyme Recognition
    written by Kate • Kate
    <p>Hello, I want to design my new experiment and I am a little bit confused.</p> <ol> <li>I have genome sequence frm sequencing project</li> <li>In the …