LncTar error
Hello,
I downloaded LncTar package from http://www.cuilab.cn/. I want to analyse RNA-RNA interaction. For this, I formatted my two input RNA fasta files according to the manual and examples provided with the LncTar package i.e.,
>RNAid1
Sequence in one line
>RNAid2
Sequence in one line
But, when I try running the command:
perl LncTar.pl -p 1 -l RNAfile1 -m RNAfile2 -d -0.1 -s T -o output.txt
I get the following error:
the format of file is error, Please check! The name and the sequence do not put in a row!
I have checked my input file multiple times, it is formatted according to the software's requirement. For your reference, both of my input files look like this:
>Cre00001921
ATGGCTCCTGGTATAGGAAGCTAATATCTTTCCTTTTTAAGGTGGGGCTAGTTCAAAG
>Cre00000880
GAATGACGCAAGCTCCTCTCTTCAATAAAGattttgaaCACAAATAATGGAATAAATCG
but I am clueless regarding this error. Can anyone help me in resolving this? Any assistance would be greatly appreciated.
Thank you
• 2,548 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Can you try passing it to the web interface and see if it works? Your data seems pretty much ok! If there's something that you're missing, the web interface should warn you!
I did actually. But then it takes a lot of time without giving any result. The server gets timed out with error 404.