Thank you guys for answers,
I am assembling bacteria reads I used velvet bze it extremely fast, low memory and can produce consensus sequence, even if it gives short reads other assembler like geneious prime 2021.0.3 requires high memory SPAdes is not working on windows and son........
Actually, the coverage was not calculated but i saw shortest contigs and total genome covered about depth i have no idea.
big problems is that genome covered after mapping to the reference contains a lots of unkown base or can be called gaps with no bases ,indicated by (??????????)
I did annotation by using prokka genome annotation, but i get fear to submit the the assembled chromosome with this gaps and unkown bases! eg. it looks like this: ATATACCCCATGGGGTACAAAAAAATTTCCCGGGAGGGGAAAAT??????????????????????
Plz help me this bionformatics is not easy
0 answers
No answers yet.
Log in to answer this question.
There no information about the sequencing technology. Also mention the number of contigs. Kbase is a very fast online server for maney kinds of assembly and annotion tools including Spades. Using different K-mers may have the possibility to reduce the number of contigs. Thank you.
So, what is your question? And what, exactly, are you trying to accomplish?