This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Find pattern that is present twice and allow <=2 mismatches on each

I have a fastq file of 400,000 reads (so speed is important). In the sequences there are barcodes integrated that should be present twice. Given a barcode, I want to find the sequences that have the barcode present twice with <= 2 mismatches. So, with a barcode 'ATTCGACCGATAGG', I would like to retrieve all of the following sequences-

>TATCTTGTGGAAAGGACGAAACACCGAACACAAAGCATAGATGCGTTTAAGAGCTATGCTGGAAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT**ATTCGACCGATAGG**GGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAG**ATTCGACCGATAGG**TGGCGTAACTAGATCTTGAGACAAA
TATCTTGTGGAAAGGACGAAACACCGGTCCGAGCAGAAGAAGAAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT**ATTCGACCGATAGG**GGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAG**ATTCGACCGATAGG**TGGCGTAACTAGATCTTGAGACAAA
TATCTTGTGGAAAGGACGAAACACCGAGTCCGAGCAGAAGAAGAAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT**ATTCGACCGATAGG**GGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAG**ATTCGACCGATAGG**TGGCGTAACTAGATCTTGAGACAAA
TATCTTGTGGAAAGGACGAAACACCGAGTCCGAGCAGAAGAAGAAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT**ATTCGACGATAGG**GGTGGCAGGGGAGGCCGAGGAGGAAGAAGGGGAGGTGGCAG**ATTCGACCGATAGG**TGGCGTAACTAGATCTTGAGACAAA

Note that the first barcode in the fourth sequence is short of one character. I have tried with biopython and regex but it's just too slow given I have 5k barcodes. I am wondering if there is a fast solution available in python or in something like grep, awk or anything else. Thanks.

fastq grep python awk barcode

Use cutadapt and control the error rate. Please read cutadapt manual for parameter explanation:

$ cutadapt --action=none --trimmed-only -g ATTCGACCGATAGG...ATTCGACCGATAGG input.fq

edit: edited for fastq, instead of fasta

Thanks for the reply. Does cutadapt allow for <=n mismatches on the barcodes?

Cutadapt allows maximum error rate or number of mismatches (n) per matched index sequence. Please read cut adapt manual on error rate.

0 answers

No answers yet.

Log in to answer this question.