This is a test version of Biostars. For the public version, visit https://www.biostars.org.
how to get the geneNames or bedfile from fasta sequences

Hi:

I have got a fasta file from a bedfile. Then I analyzed the fasta file and many motifs from the fasta sequeces (about 400bp each).

Now I used grep -i motif fastafile >> new_fastafile to get all the sequences that contains the motif. The structure of the new_fastafile is like this (not all the content of the head command):

$ head new_fastafile.fasta 
GTAAGTGGCACCCTGCCAGAGATCCCTCTCTGCCCTGGGTCTCATGCCTTCCTTTCTGCACCTCCAGACAATTTCTGCTGCCCCTAGGTCCCAGATTTCAGCTGTCCAGATGTCCAGGCCTTTTAAAGGGTCTAGGCAGGGGGTCCTACTGCTCACACAGTCCTCCCACTGGCTGTTATGTTTAAAATCCTAACCTGGC
GTAGGTGTGGACGACAGACAGCTGGGTGGCATGAGAATGCAGGTGCCAGGCGAACTAGAGGGTGGTGCTGGGTGCGTCGTACCATCGGGAGAAGATCCCCTCCCCCTCAGCCTCTGCTGAAAGCAACAAGGGAACCCCTAAAAGAAGGGCTAAGAAGGTATGCACAAGATACTGGGTCTTCCCCAAGAATGGGGCTGGA
GTGGGTAGCCTGGGGACCCCTAGCACCCCAGCCTTCACCACCATCACCTTCATCGCCACCATTACTGCGCTCACCTCCGGCTTGATCACTCAGTGTCATCCTGTGCTGGACGCTGTGCTGGGCCACCATGCCATGTTAAGTCATCCTGCCTCTCATACCATCATCACCTTGTTCACCTGTCAGGGGAGATGTAGGGGAG

How can I get the coordinates or geneNames so that I can know which genes these sequences come from? Thanks,

rna-seq genome gene chip-seq
• 1,992 views • link
updated by xiaoguang xiaoguang • written by Kai_Qi Kai_Qi

1 answer

you can use ncbi-blast to realign this motif sequence to your reference.

• 0 views • link
written by xiaoguang xiaoguang

Thanks for your reply. I did not express the situation fully. For example, I got a motif like this: GGTNNAAA, I can not blast it in NCBI. Second, I got the motif from fltered fasta files.

• 0 views • link
written by Kai_Qi Kai_Qi

I think you must have one complete reference genome, otherwise you can not get the filtered fasta file. you first download local ncbi-blast program and using your reference to make database. Then you can blast your motif to your reference database to get coordinates

• 0 views • link
written by xiaoguang xiaoguang

I see what you mean. I will have a try on the advice. I have retried to get a new fasta file yesterday. I used grep to get the header of the fasta file into a csv or txt file.

The format in the output txt file is like this: 

>7:127020805-127021004(-)

I am wondering how to convert the txt file into bed, so that I can tried bed with GTF.

I have used cut -f but does not work well.

• 0 views • link
written by Kai_Qi Kai_Qi

probably you need python or R？Maybe you should parse your coordinate to chromosome, start,end,strand. then make a six column file delimited by "\t", which contains chromosome,start,end,name,score and strand.

• 0 views • link
written by xiaoguang xiaoguang

also ,excel can help you

• 0 views • link
written by xiaoguang xiaoguang

Log in to answer this question.

More posts like this