Hi all,
I was wondering if there are any methods to extract reads containing the primer sequence.
My goal is to identify the transcript borders from reads, thus, I think if I could collect reads with primer mark, then these reads could represent the border part of transcripts. Then, mapping them back to the genome might give me information on TSS and TES.
My experiment is built RNA-Seq with "TruSeq Stranded mRNA LT Sample Prep Kit" to prepare the library. This kit uses Oligo-dT beads to capture polyA tails.
Any comments are welcome.
Thank you in advance.
2 answers
You can use bbduk.sh from BBMap suite in filter mode. Replace the sequence of the primer in place of the sequence in command below.
Single-end data:
bbduk.sh in=your.fq literal=CCAGGTAGTAGTACGTCTGTT k=10 outm=interesting_seq.fq
Paired-end data:
bbduk.sh in1=your_R1.fq in2=your_R2.fq literal=CCAGGTAGTAGTACGTCTGTT k=10 outm=stdout.fq | reformat.sh in=stdin.fq out1=interesting_R1.fq out2=interesting_R2.fq
Are you completely sure that will work?
Because:
The Poly-A containing mRNA molecules are purified using poly-T oligo attached magnetic beads. Following purification, the mRNA is fragmented into small pieces using divalent cations under elevated temperature.
Log in to answer this question.
-
Low mapping after Cufflinks assembly
written by sofiablancoglez •
-
Single-end strand specific Rna-Seq: Which strand that the reads from.
written by Chilly •
-
PolyA+ selected RNA-seq and non-polyadenylated lncRNAs
written by Josh •
-
how to choose library type for single-end 454 sequencing?
written by Ruixuan •
-
Tophat problem - R1 and R2 reads mapped to different strandeds of viral genome
written by WZOUXM •
-
trimming RNA-seq reads with adapter sequence?index? using trimmomatic
written by woongjaej •
-
SRA data sets and runs
written by MAPK
-
Please advise me on PE sequencing reads prepared by NEBNex kit and Hiseq2000
written by seta
-
SMARTer small RNA Seq Kit (CLONTECH) Poly A Trimming.
written by aldosmontreux •
-
Interpretation of Gene Body Distribution from nuclear RNA-Seq
written by achamess
