This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Getting irregular bam files when running bowtie2 with the -un-conc command

Hello. I run a bash script with the following command:

bowtie2 -x "/path/common_carp" -1 "/A1_TAGCTT_L001_R1_001.fastq" -2 "/A1_TAGCTT_L001_R2_001.fastq" -p 10 --sensitive-local --dovetail --reorder --un-conc "bowtie2/A1_L1.sam"

Instead of getting files or a file that start with the following structure:

@sq SN:NC_031699.1 LN:20567433

@sq SN:NC_031700.1 LN:11347241

@sq SN:NC_031701.1 LN:20922272

@sq SN:NC_031702.1 LN:19716050

@sq SN:NC_031703.1 LN:14157913

I get two files with the following structure:

@HISEQ:169:H733NBCX2:1:1101:1086:2059 2:N:0:TAGCTT

TACAAAAATCTATGAGATTTTAAATTTATTCGGATATTCAAATAATTTTAAGTTCAATAAATATCACTACTCTATGTCGGATGAATATTTCCCATCCTCAG

+

GGGGGIIIIIIIIIIIIIIGIIIIIIIIIIIIGIIGGGGGIIIIIIIIIIIIIIIIIIIIIIIIIIGIIGIIGIIIIIIIIIIIIGGIIIIIIGIGGIGIG

@HISEQ:169:H733NBCX2:1:1101:1044:2076 2:N:0:TAGCTT
TCGAATGATTCGCAGTAAGTTGTGGATAATGCACGTGGTTCTTAATATTGGGTTTTTTATCTACTTAATAAACCTTGCAATCAGCTGAATAAAAGCTACCA

+

AGGGAGGGGGAGAGGGGGGGIGGAGGGGGGGGAGGIGGIIIIGGGIIGGAGGGGGAGGGGAGGGGGGGGAAGGAGGGGGGGGGGGGIIGGAGGIGGGG
@HISEQ:169:H733NBCX2:1:1101:1071:2081 2:N:0:TAGCTT
CAAACTTAAACTCTTTCCCGGAGTCTGAGTAAATACATAAATCTTGAATTATAAGTCTATCCTGAAATAAATCTATCTTTAGACCTAGTTCTGCAGACCCT

+

AGGGGIIGIIIIIIIIIIIIGIGIIGGGGGGIIIIIIIIIIIGGGIIIGIIIIIIIIIIGGIGIIIIIIIIIGIGGGGIIIIGIGIIIIIIIIIIIIIGGG

@HISEQ:169:H733NBCX2:1:1101:1248:2083 2:N:0:TAGCTT
GATTTGTCTTTTCACAATTTGTGTAAGAATATTATAGTCAAGAGTATCATTATTTAAATGGCATTCCACAATCATTTGGGTGTGGCATTATTTTCTAGTCG

From what I saw, adding the --un-conc command is what leads to writing the irregular files (--un-conc is supposed to tell bowtie2 to output the reads that don't align with the reference genome).

Is there something wrong with the command? Thanks!

bowtie2
• 1,461 views • link
written by langziv • langziv

2 answers

The problem was that I thought I was supposed to get sam format files but actually got fastq files.

• 0 views • link
written by langziv • langziv

Unaligned reads are returned in fastq format, this is what you see there. Since there is no positional information BAM (or SAM) format would be pointless.

• 0 views • link
written by ATpoint ATpoint

Thanks for your answer. What do you mean by positional information?

• 0 views • link
written by langziv • langziv

SAM files contain the mapping coordinates if reads are aligned. For unaligned reads that obviously makes no sense therefore no SAM for them with that option.

• 0 views • link
written by ATpoint ATpoint

Log in to answer this question.

More posts like this