Message ID#30 Error: Subject string not found in the CGI context

Hi everybody, I have a problem with blastn of NCBI. I try to blast the my sequence of primers vs all the deposed sequences on NCBI and when I click on BLAST appear the message: "Message ID#30 Error: Subject string not found in the CGI context". What does it means? Have a nice day Giorgia

primer sequence ncbi error

• 5,276 views • link

written 5.8 years ago by Giorgia •

Are your input sequences in multi-fasta format? Can you share a few example sequences? If not, you may want to write to BLAST support and ask.

• 0 views • link

written 5.8 years ago by GenoMax

0 answers

No answers yet.

More posts like this

Error while running blastn
written 4.2 years ago by Nir •

Hi I am trying to run blastn on my database. I have created a database with 10,000 DNA sequences. I used this command: $ makeblastdb …
Running blastn to get best hits match using (-max_target_seqs 1 -max_hsps 1 ) ?
written 5.4 years ago by sunnykevin97

Hi, I had **43579** ORFs predicted using Transdecoder from one RNA seq dataset, using blastn I blasted them to a nt db using the below …
Error: NCBI C++ Exception: Error pre-fetching sequence data
written 8.4 years ago by 1291016966 •

Hi all, Recently, I run blastn on ubuntu. The command just as below: nohup /analysis/Software/ncbi-blast-2.6.0+/bin/blastn -query data/S08-C-1-K.1.fasta -db /database/blast_db/h_abfpv_genome -out blastn_m6.out -outfmt 6 -evalue 1e-5 …
blastn query coverage filter
written 10.0 years ago by fortwatts •

I have test.fasta consisting of a single header and read: \>why_no_blast_hit CTGATATCTACATACGTACTCGAGCATCGATCGATGACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCGAGCATCGATCGATGTACAGCTACGTACGTCTTGAGCATCGATCGATGTACAGCTACG TACGTCGAGATCAGAGTGA Using this as the query in the latest version of blast+ and …
blastn no hit found for very short sequences
written 10.1 years ago by exp.sherry •

I am trying to blast a set of primers (I picked from reference genomic sequences), but for all of the short primers (<= 15nts), I …
Why there is a big difference for blastn and blastx results of a given sequence
written 10.3 years ago by seta

Hi all, I locally performed blastx analysis for some sequences using ncbi-blast-2.2.30+ package. Now, when I randomly select one sequence and subject to on line …
NCBI error report
written 10.4 years ago by archana.bioinfo87

Hi all, I am getting this Message ID#29 Error: Query string not found in the CGI context; when I am trying to align two or …
how to execute mask filtering_algorithm
written 11.5 years ago by vigneshprbh37 •

can anyone suggest the execution string for , > -db_soft_mask filtering_algorithm > -db_hard_mask filtering_algorithm I tried the manual version but it didn't specify any masking …
Usage Of Format Specifiers For Blastx In Ncbi Standalone Blast
written 14.7 years ago by Raghul

<p>Hi to all I am doing blastx with ncbi standalone blast for large number of sequences. I am getting the output in outfmt -7 (tabular …
Ncbi Blast Failing For Unknown Reasons
written 14.8 years ago by Jesse J

<p>I have a Python script that runs BioPython's Web Blast function. We're using large fasta files, so the script breaks these files into smaller files …