SPAdes v3.14 unable to find files despite correct file path
I am trying to assembly a metagenome with spades but it is unable to locate the files:
== Error == file not found: /home/lamma/ABR/Meta_Spades_J/1_data/Each_sample/pilot/Green_Baln_Mnat-unmap_1.fastq: (left reads, library number: 1, library type: paired-end)
Yet this is the correct filepath as shown with:
less /home/lamma/ABR/Meta_Spades_J/1_data/Each_sample/pilot/Green_Baln_Mnat-unmap_1.fastq
@V300027027L1C001R0191219904
AAGAATTGAGATTAACCGTGAGTATTTCAGAGGGATCTTTCCGCAAGTGCAATATCGTAACTCTTACGGTGAATTAAGAGAACGTGATTACACTTCACTA
+
CGGGEEEEEGGAGGEEDBGGGBGEEEEEFEFEFGFEEEEFGEGEFFGFBEGEEEGFEBEFBDEEGEGGFEEFEBG=FEDEFFEEFF:FEFGEGGGEEGGE
@V300027027L1C001R0191221388
GTTTTTGCGCTTTCTTGGCTCAGAGTGCTCGTTGCTGACCCGGCGGGCTGTGCAAGGACGTTGAACGGGACGGCCGTGCCAATGGTTAAAAGCGAAACGA
+
FFFFFFGFFFFFFFBFFDFFFFC>FEFFFF=FCFFFFFFFFCFFDFEF?EEFB=DEFDCFBEG9FCBF94FFF=FGDGEF?EBFF?FCFF0FCF>FFFCB
@V300027027L1C001R0191221767
AAGCGGTGTCATGTTCATCGGCTCGAGCGTCGCAAGCTCAGCAAGCGCCGCAGAAGGTTCTGTCTCTTCAAAAAGCGAGAGCTGCTCTTTTTCCTTTGAG
Any help would be great!
EDIT: Commands used are as below:
metaspades.py -1 $fwd -2 $rvs -o $outdir
#variable values
echo $fwd
/home/lamma/ABR/Meta_Spades_J/1_data/Each_sample/pilot/Green_Baln_Mnat-unmap_1.fastq
echo $rvs
/home/lamma/ABR/Meta_Spades_J/1_data/Each_sample/pilot/Green_Baln_Mnat-unmap_2.fastq
echo $outdir
/home/lamma/ABR/Meta_Spades_J/1_data/Each_sample/pilot/spades-output/Green_Baln_Mnat-unmap
#Version check
metaspades.py -v
SPAdes genome assembler v3.14.0 [metaSPAdes mode]
• 4,351 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Share the command you are using.
I have added the commands
Using metaspades v3.14 right now myself. Can you edit your question posting the spades command as well?
I have added the commands
Is all of this inside a shell script? If so, could you try to execute it from the command line and see if it works? Sometimes variables within shell scripts require special handling.
Tried in command line and it runs correctly. I seems to remember having this error another time with spades but can't remember the cause
Try putting the variables within curly brackets (e.g.
${rvs})using just {} gives the same error
metaspades.py -1 ${fwd} -2 ${rvs} -o ${outdir}Otherwise you can also wrap variables in double quotes (e.g.
"${rvs}") so that the interpreter is forced to analyze them and render them as text.That means the shell you are currently in understands those variables and is able to find the files.
Are you submitting this as a job under a job scheduler? If that is the case the job likely is running on a node that does not have the particular file path available.
I am slurm so yes. How can I ensure the node has the file path? If the node does not then how come
echo $fwdprints the expected output to the stdoutThe variable has that value so it gets printed but it does not mean the path can be found on the actual node the job ran on (if that storage is not mounted on that node). You will need to check on this with your local sys admins.
I have the same problem. Strange, but I tried to put the library in the same directory with spades and it worked...