Hi, I'm pretty new to this area and is wondering anyone could help. I have a pair-ended RNA-seq data. What I'd like to do is to extract reads with a certain sequence in the 5' end of read2 from a fastq file, for example TTTTT. I've tried with BBDuk as below.

bbduk.sh -Xmx1g in1=read1.fastq in2=read2.fastq outm1=read1.filtered.fastq outm2=read2.filtered.fastq literal=TTTTT k=5 rcomp=f mm=f restrictleft=5

then I get read2.filtered.fastq mostly starting from TTTTT. However, when I do

cat read2.filtered.fastq | awk '(NR%4==2){print}' | grep -v "^TTTTT"

then there are many reads that do not start with TTTTT. For example,

ACTTACTGAGTTTTAAATGGTATAAATTTCTGGCATCTGGCAGGTG CTGCCACACACCCCAGTGGGCTTGGGGCCTGGCTGGAACTATTCAC GTCCCAAATATTCACTATGCCTTCTTTGGTGCCGGAAACTAACAGT TCCAAAACATTATCATTTCAATATGTAATCAACATAAAAAAATAAG

Why are these reads extracted? Where did I do wrong? Any suggestion would be really appreciated.