edit FASTA file according to range positions

Hello everyone,

I am trying to replace the sequences from file_1.fasta with specific sequences from file_2.fasta. The files are set up this way:

head -2 file_1.fasta 
>Scaffolds_1
TAAATCAAATTGGACAGTCAATGCTATTATGTCTCAATCTACAACACATAATACACAATT
CCAAACCACCTTCTTGGAATATCCACATTTTCTTTATTGGAAGAGAAATTAGTTTAACAA
TGACCACTCTTTTTCTCACTAATGTTACAACCACCTAGAAACTGAATTTCAAGCCTATAC

head -6 file_2.fasta 
>Scaffolds_1:327519-327900
AAATCAAATTGGACAGTCAATGCTATTATGTCTCAATCTACAACACATAAT
>Scaffolds_1:344277-344478
ACCTTTGAAACTTTGACTCTAACTCAGCTTGAATATTGGAAGTTAGGGGT
>Scaffolds_1:345134-345287
CCTTCTCTGCTAGAACACGTAGGGCCACTTCAGTAGATTCGCCAATCTTT

I have tried to set up a script to replace the sequences at the right coordinates, but got a bit confused with the sed script.

Would anybody know if there is simple tool (Samtools, Biopython) designed to make this kind of replacement?

alignment fasta bed samtools

• 2,244 views • link

written 5.9 years ago by Begonia_pavonina •

Hi,

Check the SeqKit toolkit. I'm not sure if does what you want, but it allows a lot of fasta/q manipulations. So, it might do it.

António

• 0 views • link

written 5.9 years ago by antonioggsousa

Not supported.

But it easy with python, for example,

In [11]: S="actgACTG"

In [12]: s="Ga"

In [13]: begin, end = 4, 5

In [14]: S[0:begin-1] + s + S[end:]
Out[14]: 'actGaCTG'

• 0 views • link

written 5.9 years ago by shenwei356

Thanks a lot for your answers.

the SeqKit toolkit is very handy to convert the fasta files to tabulated files (with seqkit fx2tab).

Your script is nice Pierre, but as I have several sequences to edit in each Scaffold, I cannot use it as it is written.

Thanks for your script shenwei356, I will have to get used to Python to use it and format the files exactly as I want.

• 0 views • link

written 5.9 years ago by Begonia_pavonina •

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized. SUBMIT ANSWER is for new answers to original question

• 0 views • link

written 5.9 years ago by GenoMax

My apologizes, I will

• 0 views • link

written 5.9 years ago by Begonia_pavonina •

1 answer

index file_1.fasta with samtools faidx

samtools faidx file_1.fasta  Scaffolds_1:1-327519 > out.fa
echo "AAATCAAATTGGACAGTCAATGCTATTATGTCTCAATCTACAACACATAAT" >> out.fa
samtools faidx file_1.fasta  Scaffolds_1:327900-344276  | grep -v '^>' >> out.fa
echo "ACCTTTGAAACTTTGACTCTAACTCAGCTTGAATATTGGAAGTTAGGGGT" >> out.fa

etc..
etc..

• 0 views • link

written 5.9 years ago by Pierre Lindenbaum

As I quote above, it is a very nice script for a single range replacement.

If there is several replacement per Scaffold, then I think another tool should be used.

Would anyone know what could be used in this specific case?

• 0 views • link

written 5.9 years ago by Begonia_pavonina •