This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Unzipping SAM files

Hi, Is there a way to get SAM files into readable FASTA format without samtools? I have a bunch of SAM files, and I need to read header and at least first lines of them. SAM files are gunzipped files, but gunzipping is not working with them.

next-gen software error
• 3,645 views • link
written by storm1907 • storm1907

Do you want to make a SAM become a FASTA?

Did you gzip the SAM files? It would be more convenient if they were converted to a BAM file.

check http://seqanswers.com/forums/showthread.php?t=6169

What you want might be done by:

cat filename.sam | awk '{OFS="\t"; print ">"$1"\n"$10}' - > filename.fasta
• 0 views • link
updated by Ram Ram • written by tiago211287 tiago211287

Hmm, I tried this, and got text file with symbols like these

>^_�^H^@�ZN_^@^C��[sd[��

>^�;i�q^? �x|^V2��폗 ��^_�字���p���㭗��᭗字字��r|= oA�p��?ޭ>=�ڭ^Sۭ�<

>���t@Q�q\]��^V��n^Rz��òز,�+ٲ˲b9���X~션�/Wk9�兘VAՅ慘�?5^Z�^Rv!�^Q^G
• 0 views • link
written by storm1907 • storm1907

What do you see when you try file <your.bam> in the command line? If it happens to be a BAM file, you will see gzip compressed data, extra field whereas it will show ASCII text, with very long lines for a SAM file. You will get a clue as to what kind of compression it is if it's neither.

• 0 views • link
written by newbio17 newbio17

The thing is that I am not even able to get bam files from sam with samtools. My theory is that bwa mem somehow changes the header in sam, therefore I need to see sam file.

• 0 views • link
written by storm1907 • storm1907

SAM files are gunzipped files but gunzipping is not working with them

SAM files are not "gunzipped". Also, if a file is already decompressed, decompressing again won't work.

• 0 views • link
written by Ram Ram

This is the header of one of my PE files after adapter trimming. Looks OK at the moment.

@M06108:35:000000000-J52R8:1:1101:10940:1268 1:N:0:21
CCCATTTCAAATCCTGTAAATCGGATAACAGTGCAAGTACAAACCTACCTCNCTTNGTTGTGTTGNAG
+
CCCCCGCGFGGGFFGGGGGGGGGD@FGGGGGF<CFGFFGGFGGGGGGGGGG#:D@#::DDDCGDF#,6
@M06108:35:000000000-J52R8:1:1101:12586:1268 1:N:0:21
AAATGCTTCAGATGATGACGCATTCACATTAGTAACAAAGGCTGTCCACCANGCG

But after BWA, I get error message from Samtools about "failed to read header"

• 0 views • link
written by storm1907 • storm1907

what is the BWA command you are running?

• 0 views • link
written by i.sudbery i.sudbery 
#!/bin/bash -x


INPATH=dir
OUTPATH=dir

reference=refseq.fasta
cd //tools/bwa-0.7.17
./bwa index $reference
for file1 in $INPATH/*.fastq.gz ;
do
        bname=$(basename $file1 )
        sample=$( cut -d'_' -f 1,2,3<<<"$bname")
        echo $bname $sample
        input1=$INPATH/$sample"_R1_001.paired.fastq.gz"
        output1=$OUTPATH/$sample"_R1_001.paired.sai"
        input2=$INPATH/$sample"_R2_001.paired.fastq.gz"
        output2=$OUTPATH/$sample"_R2_001.paired.sai"
        outfile=$OUTPATH/$sample".sam"
        echo $input1 $output1 $input2 $output2
        ./bwa mem -t 8 $reference $input1 $input2 | gzip -3 > $outfile
        echo $outfile
done
• 0 views • link
written by storm1907 • storm1907 
gzip -3

Why are you doing this? You are gzipping your file no wonder you get those binary characters. You can directly feed the output of bwa mem to samtools to generate the sorted BAM files.

bwa mem ref.fa read1.fq read2.fq | samtools sort -o sortedbam.bam -
• 0 views • link
written by GenoMax GenoMax

Yep, I removed it from code. Now it looks like BWA MEM is adding filename before header

>@SQ

>@PG
/dir/subdir/file.paired.fastq.gz
>M06108:35:000000000-J52R8:1:1101:10027:1270
AGTCTTGTAAAACCTTCTTTTTACNTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGG
>M06108:35:000000000-J52R8:1:1101:10027:1270
ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATC
• 0 views • link
written by storm1907 • storm1907

This does not look right. You should get an output that is in SAM format (if you just removed the gzip). Page 2 in SAM format spec.

• 0 views • link
written by GenoMax GenoMax

Problem solved. -R option is necessary in BWA MEM - to add read groups header (important for samtools), otherwise I could not get any further

• 0 views • link
written by storm1907 • storm1907

0 answers

No answers yet.

Log in to answer this question.

More posts like this