This is a test version of Biostars. For the public version, visit https://www.biostars.org.
how to run CD-Search with python or biopython

I'm now using the Biopython Entrez method to handle a great deal of sequencing. But I'm now facing a new problem,that is predicting the conserved domain in the sequence ( my sequences are DNA sequence.) I know this website: https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi . But I'd like to know how could I handle this website with python or Biopython?

biopython

You can use a module called Selenium in Python to access CD Search. From there, it is just a way to find the elements that you want.

For example, you can do a little search for a especific sequence with the following script:

from selenium import webdriver
from selenium.webdriver.common.keys import Keys

# make sure to download the chromedriver.exe and put in a known location
driver = webdriver.Chrome(
    executable_path="C:/Program Files (x86)/chromedriver.exe")
driver.get("https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi")


# this textarea correspond to the box where you past the desired sequence
textarea = driver.find_elements_by_tag_name('textarea')[0]


# this command send the sequence you want to search
textarea.send_keys("CTCTAGAAACATGACATAGGGTCCACA")
# the button variable searchs for the submit button
button = driver.find_element_by_id('sbmt_newsearch')
button.click()

1 answer

I've written a code for the Batch CD-Search, which currently works for macOS but might work for windows as well with some tweaks which I've made some notes for. Here is a summary of what the code does (Bear with me, because this might be a long one):

  1. Takes an input DIRECTORY, parses all the fasta files into a dictionary
  2. Splits the fasta file into 950 sequence chunks to comply to the 1000 seq limit of the batch mode
  3. Uses Selenium to open new windows and search paste the sequences
  4. Implements explicits WebDriverWaits to make sure everything runs smoothly
  5. Download the concise hit data
  6. Deposits the download into an output directory in the same location as the input called "CDsearch_batch_res"

Here is what the code cannot do (yet, I will work on these soon):

  1. Alter the CD-search search parameters (evalue, database to search, max aligns, etc)
  2. Download specific files (full, superfamily, alignments, etc.)
  3. Make sure that it's fully compatible to all operating systems

I've used it myself to to a monte-carlo substitution experiment to see if sequences would be identifiable by the CD-search after n substitutions, which was on a database well over 50,000 sequences. Hope it helps!

ALSO NOTE THAT YOU NEED TO SET UP CHROME WEB DRIVER YOURSELF!

Hope it helps!

      """
      Takes an input fasta file, splits it, and iteratively searchs the NCBI conserved
      domain BATCH search website for hits & returns sequences with specified hits.

      - Requires selenium to be installed
      - Requires a specified webdriver (Chrome by default)
      - Waits for your browser for a maximum of 10 minutes if browser freezes
      - Requires you to modify the Keys.COMMAND if you use windows

      """

      #! /usr/local/bin/python3.10

      import os
      from itertools import islice
      from selenium import webdriver
      from selenium.webdriver.support.ui import WebDriverWait
      from selenium.webdriver.support import expected_conditions as EC
      from selenium.webdriver.common.by import By
      from selenium.common.exceptions import TimeoutException
      from selenium.webdriver.chrome.options import Options
      from selenium.webdriver.common.keys import Keys
      import pyperclip

      inputdir = input("\nEnter the input file directory with all fasta files: ")
      maxseqinput = input(
          "\nEnter the maximum number of sequences to load in each entry (max 950): "
      )


      # Read input file fasta file function
      def fasta2dict(fastafile):
          """Reads a fasta file and returns a dictionary"""
          try:
              with open(fastafile, "r", errors="ignore", encoding="UTF-8") as inputfile:
                  content = inputfile.read()
                  contentsplit = content.split(">")

                  cleanlist = []
                  for seql in contentsplit:
                      seqr = repr(seql)
                      clean = seqr.replace("\\n", "*NEWLINE*", 1)
                      clean2 = clean.replace("\\n", "")
                      clean3 = clean2.replace("'", "")
                      cleanlist.append(clean3)

                  seq_dict = {}
                  for seqc in cleanlist:
                      seqto = seqc
                      seqsplit = seqto.split("*NEWLINE*")
                      if len(seqsplit) > 1:
                          seqkey = ">" + seqsplit[0]
                          seq_dict[seqkey] = seqsplit[1]

                  return seq_dict

          except FileNotFoundError:
              print("Could not open/read file: ", fastafile)


      # split fasta dictionary into 950 sequence chunks for CDD batch results
      def chunks(inputdict, maxsize=950):
          """split fasta dictionary into 950 sequence chunks for CDD batch results"""
          it_value = iter(inputdict)
          for i in range(0, len(inputdict), maxsize):
              yield {k: inputdict[k] for k in islice(it_value, maxsize)}


      # make new output directory
      os.chdir(inputdir)
      outputdir = os.path.join(inputdir, "CDsearch_batch_res")
      FILECNTNAME = 1
      while True:
          try:
              os.mkdir(outputdir)
              break
          except FileExistsError:
              outputdir += "_" + str(FILECNTNAME)
              FILECNTNAME += 1


      # check to see if file has already been procssessed
      for filename in os.listdir(inputdir):
          os.chdir(inputdir)
          # extract different filename components
          root, ext = os.path.splitext(filename)

          # check to see if file is fasta or fa format
          if filename == "CDD_batch_res":
              continue

          if ext in (".fa", ".fasta", ".fna"):

              # read fasta file
              sequencedict = fasta2dict(filename)

              for sliceddict in chunks(sequencedict, int(maxseqinput)):

                  # convert dictionary into string to input into NCBI search text box
                  SEQUENCE = "\n".join(
                      "\n".join((key, val)) for (key, val) in sliceddict.items()
                  )

                  # make sure to download the chromedriver.exe and place it in a known location

                  # set the default download location to output directory
                  chromeopt = webdriver.ChromeOptions()  # object of ChromeOptions
                  prefs = {"download.default_directory": outputdir}
                  chromeopt.add_experimental_option("prefs", prefs)

                  driver = webdriver.Chrome(chrome_options=chromeopt)
                  driver.get("https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi")

                  DELAY = 10 * 60  # the MAXIMUM time that the program will wait
                  # this textarea correspond to the box where you past the desired sequence
                  TXTBOX = '//*[@id="frm_New_Search"]/div/table/tbody/tr/td/table/tbody/tr[1]/td[1]/div[2]/textarea'
                  SRCHBTT = '//*[@id="frm_New_Search"]/div/table/tbody/tr/td/table/tbody/tr[2]/td/table/tbody/tr/td[3]/input'
                  DWNLDHBTT = '//*[@id="tbl_DLPanel"]/tbody/tr[3]/td[3]/input'

                  textarea = (
                      WebDriverWait(driver, DELAY)
                      .until(EC.visibility_of_element_located((By.XPATH, TXTBOX)))
                      .find_elements(By.XPATH, TXTBOX)
                  )[0]

                  # this command send the sequence you want to search
                  # pyperclip is used to paste lots of text very fast
                  pyperclip.copy(SEQUENCE)
                  # you need to change this to Keys.CONTROL for windows
                  textarea.send_keys(Keys.COMMAND, "v")

                  # the button variable searchs for the submit button
                  try:
                      subbutton = (
                          WebDriverWait(driver, DELAY)
                          .until(EC.visibility_of_element_located((By.XPATH, SRCHBTT)))
                          .find_element(By.XPATH, SRCHBTT)
                      )
                      subbutton.click()
                  except TimeoutException as ex:
                      ISRUNNING = 0
                      print("Exception has been thrown. " + str(ex))
                      driver.close()

                  # Wait until the results page is loaded and download results
                  try:
                      downbutton = (
                          WebDriverWait(driver, DELAY)
                          .until(EC.visibility_of_element_located((By.XPATH, DWNLDHBTT)))
                          .find_element(By.XPATH, DWNLDHBTT)
                      )
                      downbutton.click()
                  except TimeoutException as ex:
                      ISRUNNING = 0
                      print("Exception has been thrown. " + str(ex))
                      driver.close()

                  # close current window
                  # driver.close()

Log in to answer this question.