Equipment necessary for pcr kit production

Good afternoon, Can anyone tell me how to built pcr kits? What are the best supplies and machine to use? Glad for any help.

pcr machine

• 258 views • link

written 6.3 years ago by anasofiamoreira94

Hello anasofiamoreira94!

We believe that this post does not fit the main topic of this site.

Not bioinformatics-related.

Please ask this in e.g. SE Biology or a suitable SubReddit.

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

• 0 views • link

written 6.3 years ago by ATpoint

0 answers

No answers yet.

More posts like this

Help plotting enrichment results - kegg terms
written 2.4 years ago by DByter •

Good afternoon, I need help with some data I obtained from an enrichment analysis I carried out using YeastEnrichR. I collected a list of enriched …
mRNA library preparation Adapter ligation
written 3.2 years ago by imran •

We are starting making our own library for mRNA sequencing, and we are totally clueless about what adapter sequence to use! I have gone through …
Extract the longest isoform from transcripts.fasta (rnaSPAdes output)
written 4.4 years ago by poecile.pal •

Good afternoon, I have fasta file `transcripts.fasta` (output of rnaSPAdes). It looks like this: >NODE_1_length_180_cov_13085.239743_g0_i0 CCTTTTTATTTCTCATCAAATGAATGGCATCTTCTTCTGGAAACCCTAGCTATTCTTAGC ATGATATTGGGGAATCTCATTGCTATGACTCAAACAAGCATGAAACGTATGCTTGCATAT TCGTCCATAGGTCAAATCGGATATGTAATTATTGGAATAATTGTTGGAGACTCAAATGAT >NODE_2_length_40_cov_5904.526310_g0_i1 AAAATTGCCGTGAGCAAACATATTAATGACGAGGAACGCT etc Here `g` is gene …
Description of nt database from NCBI
written 5.6 years ago by anasofiamoreira94

Good afternoon, I can't find how NCBI builds nt database, and what's the meaning of each file extension. Can someone tell where I can read, …
Different results between remote and online blast
written 6.4 years ago by anasofiamoreira94

I perform remote blast with this command line: blastn -task megablast -num_threads 6 -outfmt "6 std ssciname" -max_target_seqs 10 -db nt_v5 -query input_file -taxidlist Plants_DB …
Running kover do not work
written 6.9 years ago by rania.assab •

Good afternoon, I am trying to run kover in my computer with the following command: kover learn scm --dataset mypath/genome_paths.tsv --split 10 and it says: …
Problems with macs2
written 8.5 years ago by anasofiamoreira94

Good afternoon, I'm working with data from ChIP-seq and now i'm using MACS2 Callpeak, however it only runs to one sample not for the other …
how to design biological pathways
written 10.4 years ago by kartikayprasad •

Hello friends, i am new in this field, can anyone please help me in designing biological pathway. how to design biological pathways? what are the …
Transposable elements search using ion torrent short single-end reads and assembled data of plant
written 10.9 years ago by mirza

Hello everyone, I have ion torrent short single-end reads and assembled data (CLC genomics workbench) of a plant. Can anyone tell me 1. I should …
How to determine if a bacterial de-novo assembly is a new species
written 11.8 years ago by cmhansen •

<p>Good afternoon!</p> <p>I am new to Biostars and to NGS, so bear with me. I have miseq data from potentially a novel species of bacteria …