This must be a simple problem and possibly there are tools available to do this. I need to create a table with SNP and reference position where those SNPs are located. I have a reference genome and contigs (in fasta) I want to check.

For example:

reference_genome: ATTGGTTGGGTTGGAAGGGGCCCA

contig: GTCGGGTTGGAGGGGGCCCA

So what I want is the position for T and A (mismatches in bold) with both reference and alternate nucleotides.

How can I get this done? Thanks for your help in advance.