Hi All, I am currently working on building an alignment algorithm.I used Mason read simulator to generate reads and test my algorithm. I am trying to validate my results using Bowtie aligner. I have not used Bowtie before and hence I am not able to accurately interpret the results it gives. The following is the command I have given for one of my reads:
./bowtie -c -a -v 1 indexes/human_chromosome1 CAGAGGTCTTAGATCTAAGTTTTTAATAAATTTAATTTGATTTTCTATATGGTGAAAGATAGGGGTCTAGTTTCAATTCTTCTGCATATGGACATCCAGTAT
I get the following result:
0 - chr1 163968523 ATACTGGATGTCCATATGCAGAAGAATTGAAACTAGACCCCTATCTTTCACCATATAGAAAATCAAATTAAATTTATTAAAAACTTAGATCTAAGACCTCTG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0 100:A>T
I understand that there is one alignment on the reverse reference strand in chr1 in the index position 163968523. What I struggle to understand is what comes after it., which is 'ATACTGGATGTCCATATGCAGAAGAATTGAAACTAGACCCCTATCTTTCACCATATAGAAAATCAAATTAAATTTATTAAAAACTTAGATCTAAGACCTCTG'. Does this mean this is the alignment in the reference to which my read gets aligned to? If yes, why are there more than one mismatches? Has this got anything to do with paired end alignment. I am new to the field and any help would be much appreciated. Thank you!
1 answer
If you look at the SAM format spec (page 6) you will see that the field is the sequence of the read that was aligned at the location you found, followed by the Q-score line.
Log in to answer this question.