This is a test version of Biostars. For the public version, visit https://www.biostars.org.
adapter trimming using trimmomatic

Hi All,

I ran fastqc on my chipseq dataset and a redflag is raised for overrepresented sequences.

29% of this sequence- GATCGGAAGAGCACACGTCTGAACTCCAGTCACACA (possible source- Trueseq adapter)

I ran trimmomatic for both Trueseq2 and Trueseq3 but both don't seem to trim anything. Any suggestions?

Thanks, Ritu

adapter-trimming next-gen-sequencing
• 1,998 views • link
updated by Ram Ram • written by GR GR

Provide command lines you used. You could also try bbduk.sh from BBMap suite which provides a common adapters file you can use in recources folder in software distribution. A guide is available.

• 0 views • link
written by GenoMax GenoMax

1 answer

Maybe my answer is not actual now, but: you can use a custom adapter sequence in trimmomatic. Here are instructions from the trimmomatic manual:

ILLUMINACLIP:<fastaWithAdaptersEtc>:<seed mismatches>:<palindrome clip threshold>:<simple clip threshold>

fastaWithAdaptersEtc: specifies the path to a fasta file containing all the adapters, PCR sequences, etc. The naming of the various sequences within this file determines how they are used. See the section below or use one of the provided adapter files

Just create fasta file with an adapter or other overrepresented sequence and feed it to trimmomatic.

• 0 views • link
written by soldatsm • soldatsm

Log in to answer this question.

More posts like this