I am trying to do a school project which requires me to create a phylogenetic tree of the entire Euphorbiaceae family, if not all at least a representative amount of it. Are there any programs that can generate it for me? Thanks!
1 answer
This is like getting an assignment to make a Stracciatella gelato, and asking if there are tools that can do that for you. Of course there are, but there are many steps before you get to use the ice cream-churning machine. Honestly, I don't know why someone would give you an assignment to build a tree of a large plant family,as it appears that you do not have much background for this task. That aside, I think it is important to appreciate the difficulty ahead of you, so the taxonomic group that you need to build a tree for is here.
There are many ways to build a phylogenetic tree, but let's say that for your purpose it can be done from a nucleotide or a protein alignment. To make life simpler for you, we will go with nucleotides, and specifically with 18S rRNA which for your group can be found here. I can't choose for you what sequences to use since there are 900+ of them, but click and make a check-mark next to whatever you want to include. Before you do that, you may want to change the drop-down menu on top that says 20 per page to 200 per page. When you choose your sequences, go back to the top and change the drop-down menu that says Summary to FASTA (text) and it will give you a screen with bunch of FASTA sequences like this:
>KP794452.1 Plukenetia brachybotrya isolate WCM_32 18S ribosomal RNA gene, partial sequence
TTGTTGGTCTTCAACGAGGAATTCCTAGTAAGCGCGAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCT
>KP794456.1 Plukenetia penninervia isolate WCM_64 18S ribosomal RNA gene
TCTTTGAAATTTCATCGTGATGGGGATAGATCATTGCAATTGTTGGTCTTCAACGAGGAATTCCTAGTAA
GCGCGAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATT
Next, you will need to align the sequences, for which I suggest SSU-ALIGN. After that you will probably want to trim the alignment, and I suggest you use trimAl.
This is now the complicated part as we are about to calculate the phylogeny. There are numerous programs for that, and they are listed by categories on this page. Briefly, you can use distance-based, Bayesian (I recommend MrBayes) or maximum likelihood (I recommend RAxML or IQ-TREE) methods for tree construction. Finally, when you make a tree use one of tree-plotting programs to look at it.
You may want to skip tree-building as described above and submit your alignment to this PhyML online tool. If you look around there may be an online tool to do the alignment and trimming for you.
Log in to answer this question.