More posts like this
-
Bioinformatics python
written by ogunjinmirashidat •In python, with open () as file, I have been trying to open a file in python but not opening. The file is located in …
-
Fasta File Python
written by cr173921 •How do I go about extracting elements from a fasta file. For example, if I want a list of all the IDS and then length …
-
help with deleting multiple fasta sequences using biopython
written by Bacteria_forever •Hi all, I need a trained python eye for this :) I need to remove 100's of genes from a proteome file contains 1000s genes. …
-
How to translate protein sequences to Nucleotide sequences?
written by Misha •I want to convert a list of fasta ( protein sequences) in a .text file into corresponding nucleotide sequences. A Google search gives me result …
-
Extract Identical hits from pairwise global alignments
written by mnsp088 •Hi! I am trying to perform 1:1 pairwise global alignments for a bunch of proteins in a fasta file. My end goal is to get …
-
Calculate pairwise distance for 3000 small sequences
written by ekal •I have a .fasta with 3000 ascensions, each of which is 10 bases long. I need to calculate the alignment score between each pair of …
-
Changing the record id in a FASTA file using BioPython
written by Jeroen Van GoeyI have the following FASTA file, `original.fasta`: ``` >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA ``` I need to change the record id from `foo` to `bar`, so I wrote …
-
Python Function That Searches For Go Terms Of Proteins
written by nadia.sl89 •<p>Hi,</p> <p>How can I make a Python function that, for each protein in a FASTA file, searches for the GO terms in UniProt?</p> <p>What is …
-
Query Two Files To The Program Fasta (Performs Pairwise Alignments)
written by martinkara7 •<p>Hello, I am rather very new to programming and am trying to design a perl script. I have two very large fasta files(one file conain …
-
Correct Way To Parse A Fasta File In Python
written by Eric NormandeauHi, I have been wondering at the correct approach in Python, maybe using Biopython, of parsing a fasta file without having to place it in …
You won't get help unless you show effort on your part. Asking people to do your homework is not the way to go.
Hello yuri!
Closed until the comment from genomax is addressed. Please be respectful and show effort.
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!