I have the following FASTA file, original.fasta:

>foo
GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA

I need to change the record id from foo to bar, so I wrote the following code:

from Bio import SeqIO

original_file = r"path\to\original.fasta"
corrected_file = r"path\to\corrected.fasta"

with open(original_file) as original, open(corrected_file, 'w') as corrected:
    records = SeqIO.parse(original_file, 'fasta')
    for record in records:
        print record.id             # prints 'foo'
        if record.id == 'foo':
            record.id = 'bar'
        print record.id             # prints 'bar' as expected
        SeqIO.write(record, corrected, 'fasta')

We printed the record id before and after the change, and get the expected result. We can even doublecheck by reading in the corrected file again with BioPython and printing out the record id:

with open(corrected_file) as corrected:
    for record in SeqIO.parse(corrected, 'fasta'):
        print record.id                  # prints 'bar', as expected

However, if we open the corrected file in a text editor, we see that the record id is not bar but bar foo:

>bar foo
GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA</pre>

We can confirm that this is what is written to the file if we read the file using plain Python:

with open(corrected_file) as corrected:
    print corrected.readlines()[0][1:] # prints 'bar foo'

Is this a bug in BioPython? And if not, what did I do wrong and how do I change the record id in a FASTA file using BioPython?