This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Simple Tutorial failing

Hi there,

I found this tutorial: https://www.ncbi.nlm.nih.gov/books/NBK52637/

See this figure:

https://www.ncbi.nlm.nih.gov/books/NBK52637/figure/blast_setup_pc.F5/?report=objectonly

The database refseq_rna.00 is installed correctly

When I do this command:

blastdbcmd -db refseq_rna.00 -entry nm_000249 -outfmt "%f" -out test_query.txt

I get the following error:

Error: [blastdbcmd] Entry not found: NM_000249
Error: [blastdbcmd] Entry or entries not found in BLAST database

Apparantly the entry isn't in refseq_rna.00 anymore? How do I know what entries are in my Blast database?

Are there more detailed tutorials about Blast and command line Blast?

Thanks in advance

rna-seq
• 814 views • link
updated by GenoMax GenoMax • written by biodreck • biodreck

1 answer

Note that these steps described above download and install only the first volume of the refseq_rna database. For the complete set, download all the refseq_rna.##.tar.gz files. The database alias file (refseq_rna.nal) in the first volume will tie all volumes back into the complete database

Downloading all files that start with refseq_rna*, decompressing them is best (if you want to use them later).

$ blastdbcmd -db refseq_rna -entry nm_000249 -outfmt "%f" -out test_query.txt
$ more test_query.txt
>NM_000249.4 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA
AGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTATTCGGCGGCTGGACGAGACAGTGGTGAA
CCGCATCGCGGCGGGGGAAGTTATCCAGCGGCCAGCTAATGCTATCAAAGAGATGATTGAGAACTGTTTAGATGCAAAAT
CCACAAGTATTCAAGTGATTGTTAAAGAGGGAGGCCTGAAGTTGATTCAGATCCAAGACAATGGCACCGGGATCAGGAAA

Otherwise it looks like that particular sequence is in chunk 05, if you just want to get that file :

$ blastdbcmd -db refseq_rna.05 -entry nm_000249 -outfmt "%f" -out test_query.txt
• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this