Thanks! I will re-run the analysis without the -html flag. Sadly it takes about 1.5 hrs :(. Does the html file have any use?
I did a multi-sequence alignment with MUSCLE and used -html to output a fasta file. When I use ctrl+O to view the file in my brower, it is just bland html code (it appears it shows up properly in this comment box):
KP223131.1 GATTTAAGTGAATAGCTTGGCTATCTCACTTCCCCTCGTTCTCTTGCAGAACTTTGATTT
The file is quite large and was rejected by all of the MSA viewers... I think this is because its in html format. What is a good way to visualize this data and why is showing up colored in this comment and not in my browser?
1 answer
There are bunch of output formats supported by MUSCLE, and HTML is probably the only one not supported by MSA viewers. All others (aligned fasta, which is default; MSF; CLUSTALW) should be viewable without any problem. Just about any MSA viewer will do a good job coloring the alignment - I like Jalview.
Log in to answer this question.