This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to view MUSCLE ouput

I did a multi-sequence alignment with MUSCLE and used -html to output a fasta file. When I use ctrl+O to view the file in my brower, it is just bland html code (it appears it shows up properly in this comment box):

KP223131.1 GATTTAAGTGAATAGCTTGGCTATCTCACTTCCCCTCGTTCTCTTGCAGAACTTTGATTT

The file is quite large and was rejected by all of the MSA viewers... I think this is because its in html format. What is a good way to visualize this data and why is showing up colored in this comment and not in my browser?

muscle msa data visualization
• 1,739 views • link
updated by Mensur Dlakic Mensur Dlakic • written by tw617 • tw617

1 answer

There are bunch of output formats supported by MUSCLE, and HTML is probably the only one not supported by MSA viewers. All others (aligned fasta, which is default; MSF; CLUSTALW) should be viewable without any problem. Just about any MSA viewer will do a good job coloring the alignment - I like Jalview.

• 0 views • link
written by Mensur Dlakic Mensur Dlakic

Thanks! I will re-run the analysis without the -html flag. Sadly it takes about 1.5 hrs :(. Does the html file have any use?

• 0 views • link
written by tw617 • tw617

Log in to answer this question.

More posts like this