This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Blastn: no output after local alignment

I tried to map a list of miRNAs to all mature miRNAs from mirbase. My query file is like;

>Bany_Scaf11_1015
UAGGAACUUCAUACCGUGCUCU
>Bany_Scaf5_35602
UCUUUGGUUAUCUAGCUGUAUGA
>Bany_Scaf19_11996
UGGAAGACUAGUGAUUUUGUUGUU

I downloaded all mature miRNAs and created the database using the command;

makeblastdb -in mature.fa -dbtype nucl -out mature -parse_seqids

Then I blast;

blastn -query sorted_mature.fa -db mature -num_threads 36 -outfmt 6 -out sorted_mature_out

In the end I got an empty output file with 0 hit...anything wrong with my analysis?

blast rna-seq rna mirna mirbase

1 answer

Most likely your query sequences are too short for BLASTn. Try adding -task blastn-short to your command or other suggestions from here and here.

Thank you! This option works well.

Log in to answer this question.