Hello! I downloaded 3 reference fasta files(IGHV, IGHD, IGHJ) on IMGT.
COMMAND like: makeblastdb –in IGHV.fasta –dbtype nucl –out IGHVdb –parse_seqids
It runs successfully when i use IGHD.fasta.
IGHD.fasta:
>J00256|IGHJ4*01|Homo sapiens|F|J-REGION|1912..1959|48 nt|3| | | | |48+0=48| | |
actactttgactactggggccaaggaaccctggtcaccgtctcctcag
>X86355|IGHJ4*02|Homo sapiens|F|J-REGION|1480..1527|48 nt|3| | | | |48+0=48| | |
actactttgactactggggccagggaaccctggtcaccgtctcctcag
>M25625|IGHJ4*03|Homo sapiens|F|J-REGION|446..493|48 nt|3| | | | |48+0=48| | |
gctactttgactactggggccaagggaccctggtcaccgtctcctcag
But when i use IGHJ.fasta, it shows: BLAST options error: IGHJ.fasta does not match input format type, default input type is FASTA.
IGHJ.fasta:
>X97051|IGHD1-1*01|Homo sapiens|F|D-REGION|33714..33730|17 nt|1| | | | |17+0=17| | |
ggtacaactggaacgac
>X13972|IGHD1-14*01|Homo sapiens|ORF|D-REGION|14518..14534|17 nt|1| | | | |17+0=17| | |
ggtataaccggaaccac
>X97051|IGHD1-20*01|Homo sapiens|F|D-REGION|62015..62031|17 nt|1| | | | |17+0=17| | |
ggtataactggaacgac
I compared IGHJ.fasta with IGHD.fasta. I didn't find obvious format difference.
I searched the fasta format online and had a try. I kept the sequence but changed the name.
So IGHJ.fasta became:
>seq1
ggtacaactggaacgac
>seq2
ggtataaccggaaccac
>seq3
ggtataactggaacgac
And it works!
So i think there must be some mistake in the sequence name, i don't know how to figure it.
Thanks for your patience!
•
written
by
xiaolongxia219 •
Think you hit a bug in makeblastdb, congratulations ;)
In conclusion, the bug seems to be triggered by the ratio of long def-line/short sequence, and only if the last character in the def-line is |.
So, either update Blast or remove some trailing empty | delimited fields. That should do the trick.
Throws the error:
>X97051|IGHD1-1*01|Homo sapiens|F|D-REGION|33714..33730|17 nt|1| | | | |17+0=17| | |
gtacaactggaacgagggggggg
$ makeblastdb -in IGHJ.fasta -dbtype nucl -out IGHFdb -parse_seqids
Building a new DB, current time: 02/18/2020 11:13:55
New DB name: ~/IGHFdb
New DB title: IGHJ.fasta
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 1000000000B
BLAST options error: IGHJ.fasta does not match input format type, default input type is FASTA
Works fine, only difference is the leading T!
>X97051|IGHD1-1*01|Homo sapiens|F|D-REGION|33714..33730|17 nt|1| | | | |17+0=17| | |
Tgtacaactggaacgagggggggg
This also works, just missing the last |:
>X97051|IGHD1-1*01|Homo sapiens|F|D-REGION|33714..33730|17 nt|1| | | | |17+0=17| |
gtacaactggaacgagggggggg
Version:
makeblastdb: 2.7.1+
Package: blast 2.7.1, build Sep 20 2018 02:20:26
Identical behavior with the latest bioconda version:
makeblastdb: 2.9.0+
Package: blast 2.9.0, build May 31 2019 20:53:30
And also LATEST:
makeblastdb: 2.10.0+
Package: blast 2.10.0, build Dec 3 2019 18:03:18
if you don't really need it (though I would personally also always add it ) you could avoid this behaviour by omitting the -parse_seqids parameter
but this is definitely a patch approach rather than a solid solution
removing -parse_seqids doesn't fix this special case.
noted, thx for looking into it Michael Dondrup
curious to hear what the NCBI blast team has to say for it ;)
They'll say: update to latest version of Blast first.
Just checked it, the behavior is exactly the same with version 2.9.0. Think it is time to tell NCBI support. Just point them to this post as a reference.
Yeah, but it's not available via bioconda. So, not today. Honestly, I don't think they have touched that piece of code for ages.
Ok, so got it, the same result for 2.10.0+
Thanks a lot! So there is some bug. However, missing the last | doesn't work for me. Weird!(Version: 2.9.0) I make the name shorter:
X97051|IGHD1-1*01|Homo sapiens|F|D-REGION|33714..33730|17 nt|1| |
And it works! So before NCBI fix this case, i think i need change all the names. : (
Log in to answer this question.
Using only the first sequence entry seems already enough to reproduce the problem.