This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Remove sequence by coordinates with Biopython

Hel lo

I have a sequence such as :

record_dict = SeqIO.to_dict(SeqIO.parse("sequence.fasta", "fasta"))

>sequence1 
AAACCCGGGTTTAAACCCGGGTTTGGGTTTGGG

and I know from this sequence how to select specific part with coordinates with : 

print(record_dict[sequence1].seq[coordinate_start:coordinate_end])
print(record_dict[sequence1].seq[3:7])

and I get : 

CCCGG

but what if I would like to remove this part from the 

>sequence1 
AAACCCGGGTTTAAACCCGGGTTTGGGTTTGGG

and get 

>sequence1 
AAACGTTTAAACCCGGGTTTGGGTTTGGG

Does someone have an idea?

Thanks for your help

Here is a better exemple 

ACCGCTTTGAATCCGAGCTAG
           ---- ----

and I want to remove 2 parts :

TCCG and GCTA with corresponds to the coordinates

11:14 and 16:19

At the end I would like to remove both and get : 

>seq
ACCGCTTTGAAAG
biopython fasta
• 2,018 views • link
written by Chvatil Chvatil

If it were a string I'd say 

print(record_dict[sequence1].seq[:3] + record_dict[sequence1].seq[7:])

But I don't know if + works for SeqIO records.

• 0 views • link
updated by GenoMax GenoMax • written by i.sudbery i.sudbery

I see what you mean but here It is an easy example, in the real data I can have thousands of coordinates, I added another exemple in order to show you.

• 0 views • link
written by Chvatil Chvatil

Assuming a list of tuples containing the coordinates you wish to remove:

ends, starts = zip(*to_remove)

final_seq = record_dict[sequence1].seq[:ends[0]]

for start, end in zip(starts[-1], ends[1]): 
   final_seq += record_dict[sequence1].seq[start:end]

final_seq = record_dict[sequence1].seq[starts[-1]:]

Again assuming you can just add seq records like that.

• 0 views • link
written by i.sudbery i.sudbery

thank you for your help

• 0 views • link
written by Chvatil Chvatil

0 answers

No answers yet.

Log in to answer this question.

More posts like this