This is a test version of Biostars. For the public version, visit https://www.biostars.org.
fetching fastq files for all samples

Hi,

I want to download all the files from this archive simultaneously:

ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/fastq/SRA166/SRA166615

How can I do this, is there wget command or anything else that might be helpful.

Regards,
Amit.

fastq
• 1,061 views • link
updated by Ram 4.5K • | written by amitpande74 2

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Unable to resolve host address
    written by Meghna 1
    I am trying to download a fastq file using its ftp link on ebi.ac.uk and using the command wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR224/002/ERR2240092/ERR2240092_2.fastq.gz on Ubuntu but I am …
  • MD5Sums of fastq files from SRA
    written by ildem 6
    Hi all, I downloaded a bunch of fastq files using wget. i.e. wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR131/072/SRR13198172/SRR13198172.fastq.gz I did this because SRA download was either failing or taking …
  • Get wget to download only new items from a list
    written by michael.flower.14 21
    I'm using wget to download a list of items. Here's a sample of the long list of links in 'cram_download_list.txt': ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR323/ERR3239319/NA12750.final.cram ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR323/ERR3239324/NA12763.final.cram ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR323/ERR3239480/HG00118.final.cram ftp://ftp.sra.ebi.ac.uk/vol1/run/ERR323/ERR3239480/HG00125.final.cram And …
  • bowtie2 making new indices
    written by amitpande74 2
    Hi, I have a sequence which includes a transposon along with a gRNA >TE TGTATGTAAACTTCCGACTTCAACTGTA I want to find this in my sample fastq files. …
  • bulkdownload fastq files from ENA
    written by amitpande74 2
    Hi, I want to download fastq files from this study. Tried pysradb, `pysradb download -p SRP165962 --out-dir`but it downloads all empty folders `anonftp@ftp-trace.ncbi.nlm.nih.gov:/sra/sra-instant/reads/ByRun/sra/SRR/SRR806/SRR8068516/SRR8068516.sra` Any better …
  • NCBI GEO: Empty FTP directory!
    written by mirzaienahal 0
    Hi, I want to download some Series Matrix Files from geo, however, its [FTP][1] directory is empty. Does NCBI move its GEO datasets somewhere else? …
  • no alias or index file found for nucleotide database nr in search path error
    written by AyehSadr 0
    Dear All I have downloaded the nr database by this command wget 'ftp://ftp.ncbi.nlm.nih.gov/blast/db/nr.*.tar.gz' and have extracted the files. When I run blastx I got this …
  • Downloading microbial genomes
    written by Bioaln 36
    Hello. I've been recently trying to download all latest assemblies of B.Subtilis genomes, using the following command: wget -nc -nH -r --cut-dirs=5 ftp://ftp.ncbi.nlm.nih.gov/genomes/genbank/bacteria/Bacillus_subtilis/latest_assembly_versions/ I wonder, …
  • convert from solid fastq to sanger fastq
    written by pcantalupo 12
    Hello, I downloaded Solid fastq file from here: ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/fastq/SRA062/SRA062077/SRX207729/. I need to convert this format into sanger fastq because the software pipeline that I wrote …
  • How To Download Esp Fastq Files
    written by syrup16g_TO 4
    <p>I want to download fastq-files of Exome Sequencing Project (ESP) of NHLBI by wget command.</p> <p>I searched the URL of ESP fastq-files, but I couldn't …