Problem in visualizing bam files to IGV
Hi I have my sorted bam files like that :
bedtools genomecov -ibam Ath_FLC4C_A_2_sorted.bam -bg | head
1:13169-20070() 0 28 13
1:20064-28278() 1733 1761 441
1:28272-29965() 1665 1693 332
1:29959-36604() 3964 3992 367
1:52850-54453() 1575 1603 1523
1:83123-87907() 4756 4784 4
1:97909-99423() 1486 1514 1
1:101231-108778() 7519 7547 1
1:109424-109532() 80 108 407
1:109526-115903() 0 28 13
and
samtools view -h Ath_FLC4C_A_2_sorted.bam | head -30
@HD VN:1.0 SO:coordinate
@SQ SN:1:1-7512() LN:7511
@SQ SN:1:7506-10949() LN:3443
@SQ SN:1:10943-13175() LN:2232
@SQ SN:1:13169-20070() LN:6901
@SQ SN:1:20064-28278() LN:8214
@SQ SN:1:28272-29965() LN:1693
@SQ SN:1:29959-36604() LN:6645
@SQ SN:1:36598-37518() LN:920
@SQ SN:1:37512-40365() LN:2853
@SQ SN:1:40359-48801() LN:8442
and i cant view it to IGV broswer. There is always an error about Sequence name '1:13169-20070() ' doesn't match regex . The genome i load is IGV is also in the same format like :
>1:13169-20070()
CCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAATCCT
ACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTTCTCTGGTTGAA
etc coming from Arabidopsis thaliana TAIR10. I believe that the problem is the format of Chromosome Notation in my bam file. Do you know how to change the format in a bam file remove the :, -, () and make it like :
Chr1 13169 20070 0 28 13
Chr1 20064 28278 1733 1761 441
Do you think that if i change this on the sam or bam file and recreate bam.bai files i will be able to visualize the results in IGV ?
• 2,361 views
•
link
0 answers
No answers yet.
Log in to answer this question.
I think TAIR chromosome names are just 1,2,3,4,5. No
chr.As for
()you could try eliminating those parenthesis withsed 's/()//g' yourfile > new_filefor all files.Yes i know so my bam files are in the correct format for my reference ,fa as i described above ! This sed doesnt work for my bam file it destroys the format and i cant view it with samtools !
Issue seems to be that
IGVcan't handle those(). You could try your luck withtablet,IGBor one of the other browsers to see if you have any luck with existing files.