After running picard ValidateSamFile I get errors for all reads like the one below - "NM" tags are missing.
WARNING: Read name SRR6251016.24364087_TGTTATGAGA, A record is missing a read group
WARNING: Record 1, Read name SRR6251016.24364087_TGTTATGAGA, NM tag (nucleotide differences) is missing
I am using bam files produced by a STAR mapping pipeline which have "nM" tags as shown below. These are identical in function to NM tags but are alternatively named.
SRR6251016.24364087_TGTTATGAGA 99 chr1 3043025 255 70M = 3043191 236 AGAAAATTGGACATAGTACTACCGGAGGATCCAGCAATACCTCTCCTGGGCATATATCCAGAAGATGCCC EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEE<<EEEEEEEEEEEEEEAAEEEE
NH:i:1 HI:i:1 AS:i:136 nM:i:1
Does anyone know how to set Picard to recognise these tags (which are of the same format) as I need to run Picard MarkDuplicates next in my analysis?
•
written
by
Ben •
1 answer
If STAR's nM was actually identical in function to the standard NM, one might ask why on earth they were making life hard for everyone by using a different tag name. But in fact it is not:
nM : is the number of mismatches per (paired) alignment, not to be confused with NM, which is the number of mismatches in each mate.
Look at STAR's --outSAMattributes option, which can be used to also output NM. One might ask the STAR developers why NM and other tags desired by Picard's “typical usage” validation are not in STAR's standard set of attributes…
Log in to answer this question.
-
bam file missing barcode and UMI info
written by malonzm1 •
-
Salmon WARNING: Detected suspicious pair
written by lluc.cabus •
-
Is my output .bam file from STAR ok?
written by elee228 •
-
featureCounts fragment count
written by xosugarxspicexo •
-
Fixing BAM file errors reported by Picard ValidateSamFile, and in featureCounts' outfile
written by Anand Rao
-
HTSeq error: local variable 'NH' referenced before assignment
written by senowinski •
-
Question: Unmapped reads at TCGA bam files
written by Folder40g
-
Htseq-count no_feature threshhold?
written by MK_B •
-
Error occurred when processing GFF file, need more than 1 value to unpack
written by rebeccakurtz62 •
-
Samtools/Picard Fixmate Not Working On A Bam With Multiple Alignments Per Read?
written by scottsmith1
Why do you want Picard to recognize these tags? I think MarkDuplicates only compares 5' end of reads without considering NM tag