No, you cannot. findMotifs.pl checks for overrepresentation which is pretty pointless with only four sequences. For these one better uses something like fimo(find individual motif occurrences) and scans the sequences against a collection of known motifs, e.g. HOCOMOCO and JASPAR, to see which TFs potentially could bind.
How to identify Transcript Factors (TF) binding to my target sequence
Hi All,
Anyone can provide some help to find Transcript Factors (TF) binding to the following 4 human target sequences? or any suggestion?
>JDZ-01
ttagggcggaaggtttgaatgg
>JDZ-02
CttagggcggaaggtttgaatggttagggcggaaggtttgaatggttagggcggaaggtttgaatggA
>JDZ-03
ctagagtcgtgcaggacgtgacatctagtgtcgtgc
>JDZ-04
ctagagtcgtgcaggacgtgacatctagtgtcgtgcaggacgtgacatctagtgtcgtgcaggacgtgacatA
Thanks.
Solved: Looks hTFtarget is a good choice:
2 answers
There are several well-annotated transcription factor binding site motif databases, like JASPAR or HOCOMOCO. Most of these databases have complementary tools that allow identification of known transcription finding binding sites in short sequences (for example - this one). You could also use universal motif finder tools like MEME. There are a lot of other tools available as well - use keywords "transcription factor binding site motif" in your google scholar searches and you will find plenty of them!
You can use Homer's findMotifs.pl to find motifs in your sequences. Homer outputs known motifs (motifs matching with the database of motifs) as well as de novo motifs.
Log in to answer this question.