This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to define output for ALT tag in vcf file

Hi everyone,

I am looking at a VCF file and at one position, under ALT I saw the following nucleotides

 T,GATCACGTGCCTGATCATGCACTT
  1. Can someone please tell what the second ALT allele (GATCACGTGCCTGATCATGCACTT) is?

In another position I see REF and ALT as following

GTGATCACGTGACTGATCATGCAC        CTGATCACGTGACTGATCATGCAC,G
  1. Please tell me how to explain this as well
snp next-gen sequencing
• 1,699 views • link
updated by GenoMax GenoMax • written by Kash Kash

1 answer

It is an insertion. Additional nucleotides have been filled in. Does this answer your question, not sure I got it correctly?

• 0 views • link
written by ATpoint ATpoint

I think OP asks about the comma, which indicates that at this position there are two alternative alleles. The samples with e.g. 0/1 genotype are heterozygous for the first alternative allele, and 2/2 would mean homozygous for the second alternative allele.

• 0 views • link
written by WouterDeCoster WouterDeCoster

Yes ATpoint that is what I wanted to know. Thank you. In the second position one of the ALT alleles is just G. Does this indicate a deletion at this position in some of the samples?

• 0 views • link
written by Kash Kash

Yes, the first case is an insertion, one allele is "T", the other is "GATCACGTGCCTGATCATGCACTT"

The second case is a deletion, your reference is "GTGATCACGTGACTGATCATGCAC", then you have one allele "CTGATCACGTGACTGATCATGCAC" (note the single substitution in the first base G->C) and a second allele as "G------------" as a deletion

• 0 views • link
written by JC JC

Now I understand it. Thank you everyone.

• 0 views • link
written by Kash Kash

Log in to answer this question.

More posts like this