Hello, I'm using mirdeep2 to analyze my small RNA seq data (50 bp). I followed their tutorial for the analysis:https://github.com/rajewsky-lab/mirdeep2/blob/master/TUTORIAL.md. I analyzed each sample separately and get the result output for each sample.
for f in \*clp.fa;do echo ${f}; miRDeep2.pl ${f} genome_main.fna ${f%_*}_to_genome.arf mature.fasta Ath_miRBase.fasta premature.fasta -z ${f%.*} 2> ${f%_*}_report.log; done
I tried to gather the reads count of each novel and known miRNA together. However, I find it very hard to integrate the results from different samples because seems the predicted novel miRNA is different in different samples. For example, I have 6 samples and most novel miRNA can be detected in 4 samples and but none of them can be detected in sample2 and sample3. There is whole different set of miRNA detected in sample2 and 3, which are not reported in other samples. Therefore, I cannot do the expression analysis using this data. I checked the QC and I don't believe there is issue/contamination in these samples.
here is part of the count summary data: (seems different samples have their own unique set of miRNA)
mirna S622 S6H2 S6122 S6H3 S623 S6121 S621 S6H1
cccuugucgcuucgauucgu 756891 590559.33 321420 779381.75 522973.75 708258 NA 767231
ath-miR166e-3p 164621.09 97016.81 59226 139494.7 146672.63 160038.63 NA 139948.09
ucaguauccgauaucagcgcaugu NA 17 NA NA NA NA NA 25
uccucguguugcaccucu NA NA 69844 63423 NA 121998 NA NA
cguuuggagcagucauaaaug NA NA 29871 12421 NA NA NA NA
uaaaagacccguauguauagcaac NA NA NA 120 NA NA NA NA
ath-miR5659 NA NA NA 11 NA NA NA NA
aaauccgaggcaccgauuugu NA NA NA NA NA NA 243 NA
guuggacacaccaaacaugcaugu NA NA NA NA NA NA 959 NA
cugaaguugcacucugggacuc NA NA NA NA NA NA 72 NA
gcggcuuggauuggauuugaucgg NA NA NA NA NA NA 27 NA
PS. I already mapped reads to the known miRNA using quantifier module. But my species only have 30 known miRNA, and there is no significant expression difference between samples using total mature reads count. That's why I need to analyze the novel miRNAs derived from different precursor. I calculated the average count as the mature miRNA expression.
0 answers
No answers yet.
Log in to answer this question.
update. I wrote a script to handle the result from mirdeep2