Trim fastq after and before motif occurance
Hi everyone,
Is there any easy way to trim a fasta/fastq before and after a certain motif occurance?
As example, this would be my sequence ATGAAACCTTTGGGGCCCCAGTCAGCTC
My motif of interest would be: GGGGCCCC
I want to trim let's say 5bp 5' and 3bp 3' of the motif occurance which would give you: CCTTTGGGGCCCCAGT
I searched around a bit but could not find any fitting tool. Any ideas/suggestions?
• 1,568 views
•
link
1 answer
Just tested seqkit amplicon which actually did exactly that (option is only available in the pre-release of version v0.11.0 so far: https://github.com/shenwei356/seqkit/releases/tag/v0.11.0-dev)
Corresponding command would be:
seqkit amplicon input.fastq -F GGGGCCCC -r -5:3 -f -o output.fastq
• 0 views
•
link
Log in to answer this question.
You can probably adapt this solution in
awk: Split a sequence in a fastq fileBecause of the unique requirement here you are likely going to need to write something yourself. Trimming programs are generally setup to trim/discard sequences (to left or right) once a particular k-mer motif is found in the sequence.
Using
bbduk.shfrom BBMap suite you can filter out reads that contain the motif of interest by doing:You can then work on that reduced dataset.