This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Subsample fasta per taxon

Hello, I have some fasta files downloaded from NCBI, containing sequences of numerous taxa each, and I would like to reduce the amount of sequences per file, i.e. pull out a fixed number of sequences per genus (or per family). I suppose its a standard operation, but I failed to find the correct approach. I have tried the obitools options obisample and obiselect, but I don't see how to specify the 'per genus' option from the taxonomy (if there is one). Perhaps someone can give me a hint what other tool (or syntax) to use for this. Any help greatly appreciated!

subsample taxon genus

Does your fasta file have a species identified in the header? Can you post a few lines from the file here?

it looks like this -

>HQ728004.1 count=1; Demodex folliculorum isolate 3-S6-Df2 28S ribosomal RNA gene, partial sequence
atcttggtggtagtagcaaatactcaagtgagaaccttgaggtccattgtggagatgggt[...]

0 answers

No answers yet.

Log in to answer this question.