I'm new to phyton. I would be graceful if you can give the exact code line you used. Something with subprocess ... ?
Hello, I've tried to install and import viennaRNA python package on a windows computer in many different ways, but none of them succeeded. (eventually I always get to 'no module named 'RNA'' message). Do anyone know what will be the right way to do so? I could not find any detailed guide. Alternatively, are there any other good python packages that calculates RNA MFE? Thank you!
1 answer
If anyone else encounters this problem I found a workaround: after downloading and installing the software from https://www.tbi.univie.ac.at/RNA/index.html#pack_windows you will get many EXEs files with the different viennaRNA features. Instead of installing to package you can run these EXEs from your python using: from subprocess import Popen, PIPE p = subprocess.Popen('RNAfold.exe', stdin=PIPE, stdout=PIPE) ans = p.communicate('ATGTTGGGTTCCCCGTGTTGAAAATGTGAAGTAT'.encode())
Just delete "subprocess.", use p = Popen('RNAfold.exe', stdin=PIPE, stdout=PIPE) instead.
Log in to answer this question.
I think we're going to need more information to be able to help. Doing this on windows complicates things a bit.
Did you use the installer from the website? https://www.tbi.univie.ac.at/RNA/index.html#pack_windows
I'm using python 3.6 (anaconda) and pycharm. I've tried to use the windows installer from https://www.tbi.univie.ac.at/RNA/index.html#pack_windows - the installer finished successfully but it had no effect on my python (still could not import the package). I've looked for a conda installation for this package but it is not suitable for windows. I tried to look for a pip installation but could not find such. I also tried to download the package directly from github (https://github.com/ViennaRNA/ViennaRNA) but could not find a way to install it from the files I got (the instructions only refers to linux installaions). Bottom line every time i try to import the package with 'import RNA' I get 'ModuleNotFoundError: No module named 'RNA''. thank you for your help!
Have you tried just running
conda install -c bioconda viennarnafrom inside the PyCharm terminal?You must make sure the python interpreter that your PyCharm project is using is the one from your conda distribution, not a system python of pycharms own.
I tried to run it from the anaconda terminal and got 'PackagesNotFoundError: The following packages are not available from current channels: -viennarna'. On anconcda's website (https://anaconda.org/bioconda/viennarna) they mention that this package is only available for linux and osx, so I guess this is the reason that it is not working. I'm absolutely sure that i'm using the right python version as my PyCharm's interpreter (i've already installed a lot of packages using pip or conda and used them in pycharm afterwards).
From the github it looks like a C program, so it doesn't make any sense to install it in python. I have only looked through a few of the directories but I don't see any python at all.
It is a C program, but they say on github that "The package includes Perl 5, Python 2, and Python 3 modules that give access to almost all functions of the C library from within the respective scripting languages" but i was not able to do so
Not true, many C (or other language programs) have python bindings to enable their use.
Conda also isn’t purely for python anymore.