This is a test version of Biostars. For the public version, visit https://www.biostars.org.
RS number in UCSC

Hi,

I have SNP and I use this tool to find the rs-number of my SNP. but it has 2 columns: ChromStart, ChromEnd.

I don't know which of this column should be compared with my SNP position.

thank you :)

snp snp

1 answer

UCSC uses an open-ended interval. The chromStart is the 0-based ( Cheat Sheet For One-Based Vs Zero-Based Coordinate Systems ) position where the SNP starts, chromEnd is the 0-based position where there is NO-MORE SNP.

hence, one can find INDELS:

$ mysql --user=genome --host=genome-mysql.soe.ucsc.edu -A -P 3306 -D hg19 -e 'select chrom,chromStart,chromEnd,name,observed ,alleles from snp142 where chromStart+1 < chromEnd limit 10 '
+-------+------------+----------+-------------+-------------------------------+--------------------------+
| chrom | chromStart | chromEnd | name        | observed                      | alleles                  |
+-------+------------+----------+-------------+-------------------------------+--------------------------+
| chr1  |      10228 |    10255 | rs200462216 | -/AACCCCTAACCCTAACCCTAAACCCTA |                          |
| chr1  |      10249 |    10251 | rs375044980 | -/AC                          |                          |
| chr1  |      10328 |    10352 | rs201106462 | -/ACCCCTAACCCTAACCCTAACCCT    |                          |
| chr1  |      10616 |    10637 | rs376342519 | -/CGCCGTTGCAAAGGCGCGCCG       | -,CGCCGTTGCAAAGGCGCGCCG, |
| chr1  |      13289 |    13291 | rs538791886 | -/CT                          | -,CT,                    |
| chr1  |      14397 |    14400 | rs370886505 | -/TGT                         |                          |
| chr1  |      14511 |    14513 | rs372598081 | -/AG                          |                          |
| chr1  |      30867 |    30871 | rs369270395 | -/CTCT                        |                          |
| chr1  |      46285 |    46288 | rs545414834 | -/TAT                         | -,TAT,                   |
| chr1  |      51714 |    51718 | rs528351826 | -/AGTT                        | -,AGTT,                  |
+-------+------------+----------+-------------+-------------------------------+--------------------------+


$ mysql --user=genome --host=genome-mysql.soe.ucsc.edu -A -P 3306 -D hg19 -e 'select chrom,chromStart,chromEnd,name,observed ,alleles from snp142 where chromStart = chromEnd limit 10 '
+-------+------------+----------+-------------+----------+---------+
| chrom | chromStart | chromEnd | name        | observed | alleles |
+-------+------------+----------+-------------+----------+---------+
| chr1  |      10056 |    10056 | rs373328635 | -/A      |         |
| chr1  |      10177 |    10177 | rs367896724 | -/C      | -,C,    |
| chr1  |      10235 |    10235 | rs540431307 | -/A      | -,A,    |
| chr1  |      10352 |    10352 | rs555500075 | -/A      | -,A,    |
| chr1  |      10353 |    10353 | rs145072688 | -/A      |         |
| chr1  |      10383 |    10383 | rs147093981 | -/C      |         |
| chr1  |      10433 |    10433 | rs56289060  | -/C      |         |
| chr1  |      15903 |    15903 | rs557514207 | -/C      | -,C,    |
| chr1  |      15904 |    15904 | rs368127301 | -/C      |         |
| chr1  |      28590 |    28590 | rs373063181 | -/TTGG   |         |
+-------+------------+----------+-------------+----------+---------+

Log in to answer this question.