Dear All,

I have a 63bp of reference sequences as follows:

>M17541
GATGGCGAGGGCGCCTTCCATGGAGACGCAGAAGCCCTTCAGCGGCCAGTAGCATCTGAC
TTT

And I have a 75bp paired-end sequencing data!

75bp of sequencing reads contains only the 22bp of the reference sequence as follows: CATGGAGACGCAGAAGCCCTTC

My question is that, How to perform a mapping between only these region using BWA or Bowtie2!

However, I have already tried the Bowtie2 with --local option and BWA with small seed length but it's not working!

Also, I have tried by masking other region of the reference sequence with 'N', but it's not working too!

Thanks!