This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Mapping of novel peptide

Dear All,

I have got a couple of novel peptides by using PGA of R Bioconductor package. Now I want to map these novel peptides into genomic context. By using which bioinformatics tool I can map my novel peptides into New TIS, novel exon, a novel gene, novel splicing, UTR translation.

Thank you.

genome
• 1,151 views • link
written by jahanshanzida • jahanshanzida

Is this a follow-up question on your previous post: Novel peptide identification ?

Do you actually have amino acid sequence now that you want to map to a genome reference?

• 0 views • link
written by GenoMax GenoMax

Yes, this is a follow-up question.I have got two peptide by PGA bioconductor in R.These are :

VFLLPLCKSS PPLLDQDQIV LLRGWFLSTW NLKCPTSNHS LEFNGTLLCP
    LVEAFSLWKP RPLSLQN

chr1:87627704-87627922_+::::LINC01140|-|F3|1

I have then collected nucleotide sequence from USCS genome browser.

gggattccctactatctggatagctagtcatgactagagaagattctgcatggagacaatatatcatttatttggcttttatttttactgaattcagtgctcatggaaagtggcacattgacaacgctgcttcctagcatgacatcacataaataagtttgaagatactgcttaataagaaccctttaaagataagagaaatggtagaaagaat

Now I want to map it like novel exon,novel gene,novel splicing so that I can understand the position of these novel peptide.Is there any tools for that.

Also,Do you know any other method so that I can make sure that these peptides are novel.

Thank you.

Shanzida.

• 0 views • link
updated by Ram Ram • written by jahanshanzida • jahanshanzida

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time for the sequence. I am not sure what the alignment/amino acid sequence is supposed to look like so you can fix that.
code_formatting

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized. SUBMIT ANSWER is for new answers to original question. Thank you!

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this