This is a test version of Biostars. For the public version, visit https://www.biostars.org.
complex pattern search in whole genomes

Hi, I am looking to find all occurrences of a nucleotide pattern in a multifasta genome, with n number of mismatches in one part of the pattern, and m number of the mismatches in the rest.

For example:

AGCAGCATAGCAGCAAGCAGT[up to 4 mismatches]GCAGACGCA[UP TO 2 MISMATCHES]

Does anyone know how to search for this type of complex pattern. An existing tool, or perl/python script ? Ambiguous symbols such as N and R incorporation would be much needed as well.

thanks for posting your answers.

genome sequence alignment
• 895 views • link
written by bioinfo1234 • bioinfo1234

Hi, I'm not aware of any tool which does this out of the box (I' would be happy to be corrected).

I have 2 suggestions:

1) implement fast scoring function and traverse the sequence

  • advantages: your own rules (regarding N, R and other stuff)
  • disadvantages: coding, slower (even with cPython)

2) use library with regex with implemented non-exact matching. eg. https://pypi.org/project/regex/

  • advantages: coding (super simple script), computation time (fast)
  • disadvantages: can't handle the (N, R....)
• 0 views • link
written by massa.kassa.sc3na massa.kassa.sc3na

0 answers

No answers yet.

Log in to answer this question.

More posts like this