Hey everyone
We have a strange sequence which has shown up in one of our Illumina sequencing runs. It is present in every sample, and is the 5th most abundant sequence overall, showing up 25,000 times each in two samples. These were demultiplexed, denoised, and classified with QIIME2.
It returns no results from a blast search - unless you use the most permissive results, which are likely chance - and was unclassifiable by sklearn using the Silva 132 database.
We used archaeal specific primers in this run. There were other unclassifiable sequences which I believe are non-target DNA, however those differ from the length of target sequences, while this sequence is the exact length of our identifiable, correct features.
Any ideas what this could be from? Is it a chimera which was missed by DADA2? Or some error from PCR?
Appreciate any help, the sequence is below:
TAAAAGAGTTGCTGGCGAACGAAGGGCGTCCCGAAGCGACAGTAGATCCTGTTATCGAGGAAATATCGGCAACCGCCGTGGGCCTTACCTTCAAGATCGTAGAGGGTCCCCGGTTCAGAGTCGCCGACATAGAGTTTGAAGGCAACACGGTCTTCTCGAGTTCTCACCTCAGAAAGAACATGAAGCTTGTGAAGAAAGTGGGTCTCCTGACCACCTTCAGCTCGAAGGACATCTACCACAAAGAAAAATTCGAAGCTGATCTTGATCGCCTCCGCGTGCTGGTATACGCCGATCAAGGCTATTTGAAAGCGAGGTTTGGAGAACCGCGAGTCGAGGAAGTAGGCAAAATCGGCAACTGGCTGCCGATCATCGGACACAAGGGCGAGGGGCTGAAGATCGTTGTTCCCGTCGAGGAAGGCCGCCAGTACCGCGCCGCAGAGGTGAAGGTTGAAGACAACACGGAGTTTACGGCCGAGGAAATCAAGGCAATCATTGGTCTCA
0 answers
No answers yet.
Log in to answer this question.