One of the top features in our 16S sequencing is very suspicious. It was not even classified to domain level using sklearn in QIIME2 on the Silva 132 database. When I blast the sequence there are no hits except with quite low scores, ~48, and high E-vales. It is the exact length of the other, assignable features.
Any ideas what kind of artifact this could be? Or how we can look more into it?
Here is the sequence TAAAAGAGTTGCTGGCGAACGAAGGGCGTCCCGAAGCGACAGTAGATCCTGTTATCGAGGAAATATCGGCAACCGCCGTGGGCCTTACCTTCAAGATCGTAGAGGGTCCCCGGTTCAGAGTCGCCGACATAGAGTTTGAAGGCAACACGGTCTTCTCGAGTTCTCACCTCAGAAAGAACATGAAGCTTGTGAAGAAAGTGGGTCTCCTGACCACCTTCAGCTCGAAGGACATCTACCACAAAGAAAAATTCGAAGCTGATCTTGATCGCCTCCGCGTGCTGGTATACGCCGATCAAGGCTATTTGAAAGCGAGGTTTGGAGAACCGCGAGTCGAGGAAGTAGGCAAAATCGGCAACTGGCTGCCGATCATCGGACACAAGGGCGAGGGGCTGAAGATCGTTGTTCCCGTCGAGGAAGGCCGCCAGTACCGCGCCGCAGAGGTGAAGGTTGAAGACAACACGGAGTTTACGGCCGAGGAAATCAAGGCAATCATTGGTCTCA
Edit: replaced sequence
1 answer
Log in to answer this question.
-
V3V4 16s Sequencing, lots of merged reads that are too short
written by Emilie •
-
Tool: Still Not Use QIIME2 for Amplicon Analysis? You’re OUT!
written by Novogene •
-
ValueError: Need a Nucleotide or Protein alphabet. Trying to write a Genbank file and getting error
written by Fishy_DNA •
-
Strange feature in Illumina sequencing results, no blast results, what could this be?
written by will.wcb •
-
Explanation of Deblur-stats output
written by shakyapramesh •
-
Make taxonomy bar plot using qiime2 and error in denoise procedure and training classifier
written by pple2202 •
-
Forum: BWA command guide
written by Chen Sun
-
How to get correct Taxonomy UID from NCBI Taxonomy using Entrez E-utilities efetch?
written by JV
-
blastp short in BLAST+ vs. BLAST web interface
written by smiller
-
Efficient strategy for remote blasting of 3000 sequences
written by frederiekmaarten.kerckhof •
Sorry, I placed the wrong sequence, here is the correct one
TAAAAGAGTTGCTGGCGAACGAAGGGCGTCCCGAAGCGACAGTAGATCCTGTTATCGAGGAAATATCGGCAACCGCCGTGGGCCTTACCTTCAAGATCGTAGAGGGTCCCCGGTTCAGAGTCGCCGACATAGAGTTTGAAGGCAACACGGTCTTCTCGAGTTCTCACCTCAGAAAGAACATGAAGCTTGTGAAGAAAGTGGGTCTCCTGACCACCTTCAGCTCGAAGGACATCTACCACAAAGAAAAATTCGAAGCTGATCTTGATCGCCTCCGCGTGCTGGTATACGCCGATCAAGGCTATTTGAAAGCGAGGTTTGGAGAACCGCGAGTCGAGGAAGTAGGCAAAATCGGCAACTGGCTGCCGATCATCGGACACAAGGGCGAGGGGCTGAAGATCGTTGTTCCCGTCGAGGAAGGCCGCCAGTACCGCGCCGCAGAGGTGAAGGTTGAAGACAACACGGAGTTTACGGCCGAGGAAATCAAGGCAATCATTGGTCTCA
Please use
ADD COMMENT/ADD REPLYwhen responding to existing posts to keep threads logically organized.SUBMIT ANSWERis for new answers to original question.Blasting that with megablast don't have any significant hit, using blastn it gives the short hits that you described, so I guess is just contamination.