fasta header trimming in a multifasta

Hi,

I have a multifasta with the transcripts of an assembled rnaseq and the header of each fasta is like this:

>TRINITY_DN5895_c0_g1_i1 len=288 path=[152:0-287] [-1, 152, -2]

I want to trim each fasta header to:

>TRINITY_DN5895_c0_g1_i1

Can you help me? Thanks

fasta header trim

• 1,326 views • link

updated 7.2 years ago by Ram

• written 7.2 years ago by ignazio.fontana •

What have you tried? There are a lot of FASTA header manipulation posts on the site. A simple sed would solve your problem.

• 0 views • link

written 7.2 years ago by Ram

This has been asked many, many times, please search. This question is so common it is asked even at very odd forums, like this one at Ask Ubuntu:

remove all letters after space in a line that start with specific character

• 0 views • link

written 7.2 years ago by h.mon

Hello ignazio.fontana!

Questions similar to yours can already be found at:

Fasta header trimming

We have closed your question to allow us to keep similar content in the same thread.

If you disagree with this please tell us why in a reply below. We'll be happy to talk about it.

Cheers!

PS: Please search the site before opening a new question - you'll probably get answers faster that way.

• 0 views • link

written 7.2 years ago by Ram

0 answers

No answers yet.

More posts like this

I want to rename sequence headers
written 3.1 years ago by Riyad •

I have assembled transcript files with thousands of sequences with headers as like: ``` >TRINITY_DN50_c0_g2_i1 len=1961 path=[0:0-1960] >TRINITY_DN59_c0_g1_i2 len=1961 path=[0:0-1960] ``` But, I want to …
Extract sequence from Fasta using header
written 4.1 years ago by Princy •

Hello, I have a list of headers, I need to extract the sequence from the fasta file. how can I do it? kindly let me …
Is there a way to change only the header of a fasta file?
written 4.6 years ago by Riku •

Dear All, I would like to change the header of the fasta file as follows, but I don't know how. The actual file is so …
Edit a Multifasta File Through awk
written 6.3 years ago by pthom010 •

I have a multifasta file that looks like this >TRINITY_DN10231_c0_g1_i1 len=1399 path=[0:0-908 1:909-912 2:913-1398] ATATATATATAT >TRINITY_DN10231_c0_g1_i2 len=1399 path=[0:0-908 1:909-912 2:913-1398] GGCGCGCGGAGAGAGA And I have a …
Extract 10 matches in BLAST
written 7.4 years ago by gkalgus •

I have a blast output in outfmt 6 format, like this: JXPU01010214 XP_021704425.1 91.21 182 16 0 3548 152 333 2e-91 287 JXPU01010214 XP_021704425.1 20.21 …
How to extract fasta sequences from assembled transcripts generated by Stringtie
written 9.2 years ago by seta

Hi all, I used STAR and stringtie for mapping reads to reference genome and assembly. As you know, the generated assembled transcripts by stringtie are …
Change trinity fasta header sequence ID's
written 10.4 years ago by HZZ0036 •

Hi all, I have a trinity fasta file and I want to change sequence ID. I tried sed, but it doesn't work. The sequences are …
FASTA sequence extraction using list of sequence name that are not identical with the headers?
written 11.1 years ago by seta

Hi all, I 'm trying to extract some sequences from a fasta file that their header are as following: ``` >c0_g1_i1 len=526 path=[27:0-525] TCTAGCTTGAAACCTGACATTAAAATGAAAAGGAGATCACTTGTAGTCCAATAAACCAAA CTAGTTTTTAGAGAAATTTATTACTGTTTTATCTTCCCAACACTTGCAAATTTAGTAAGG …
Trinity de novo transcript assembly too many transcripts
written 11.1 years ago by Mehmet

Dear All, I have completed Trinity de novo assembly for a worm species. The k-mer that I used was 25. Then, I have had too …
removing part of the fasta header from multifasta file
written 12.1 years ago by 2kg2523 •

I was trying to delete some words (strings) from sequence header from multifasta file. I want to eliminate `len=` and `path=[...]` so finally I would …