This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to trim primers with cutadapt from .fastq.gz file?

I tried to trim primers from my fastq.gz files with cutadapt, but It trims whole a lot than I intended. In same cases It trims whole genes. The command I used for trimming:

cutadapt -a file:reverse.fasta -G file:forward.fasta -o out_R1.fastq.gz -p out_R2.fastq.gz  in_R1.fastq.gz in_R2.fastq.gz

reverse.fasta is for reverse primers and forward.fasta is for forward primers.

These how I prepared my fasta files: for reverse,

>r1                                                          
ACAGAGGCTTCTTTTCCTACCAG        
>r2
GTTCAAGCTGCAGAACACCAG
>r3
GAATCTTGGGCCCTAAACGTG

for forward,

>r1
CTTCCCCATAGTAGGTGACCAG
>r2
AGACTCCCAATCCCCAGGTC
>r3
GGCCTTCTCTCTGCGTTTG

I don't why It trims unintended places maybe there is something wrong with my fasta file. If It possible to trim primers in cutadapt, I would like to hear your suggestions or If there is any other tool that I can use.

Any help is much appreciated.

Thanks in advance.

cutadapt primer trim

hi bayramliaziz , I changed the category of your post to 'question' in stead of tool as we keep the latter for (new) tool announcements.

1 answer

The adapters you define for the second read are 5' adapters so everything before them will be removed, usually you would like to have both sides with the same type of adapter meaning -a with -A and -g with -G

When I use -a and -A, I get the following warning: WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above.

But when I use -g and -G, It deletes whole gene again. When I look at the IGV, I see trimmed genes.

You first have to figure out what your adapters are, where you expect them and then run the software. In addition, what do you mean by trimmed genes? cutadapt is used for reads

Log in to answer this question.