Illumina reaction on bad nucleotide quality
What will write Illumina if my quality will be @@@@? How will it react? Or it'll be possible only if i'll have a null string?
sequencing
• 579 views
•
link
written
by
doramora •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Get average quality score per position in an aligned bam file
written by cedric.blais •I have a bam file of nanopore reads aligned to a reference. I would like to calculate the average quality score of all bases mapping …
-
R code for KEGG pathways output
written by doramora •Hello! I was trying to write a code in R, where I input all my genes names and I wanted to get an output as …
-
How to create a basic GUI for rna seq pipeline
written by pubsurfted •Hello everyone. I'm a bio core student who needs guidance regarding which tools to use and where. I have a project in which I want …
-
RepBase27.07.fasta.tar.gz
written by ar14g12 •Hi, Does anyone have a copy of RepBase27.07.fasta.tar.gz? I'll need it for TE analysis, I don't have any subscription to Repbase, this would be really …
-
Illumina technology output, 16S amplicon
written by Jelo •Hello everyone I am new to NGS and confusing about the sequence output If the fragment of DNA (e.g. GACTACACGGGTATCTAATCCCGTTCGCTCCCCTGGCTTTCGCGCCTCAG) will occur only once after …
-
Fastq quality string, quality
written by vascoambrogi •I began reading into a fastq file of reads around 130 bp of my whole genome sequencing. What caught my eye were the quality string …
-
Mapping quality score of clipped reads
written by radwa.raed •Hi, I have a question please. For soft-clipped or hard-clipped reads, for example a read with a cigar string 100M50S, does the mapping quality score …
-
How to align reads on reference using python?
written by doramora •It may sound quiet easy (for you), so i want to find a bit of help there. How to align reads on reference? I've got …
-
GATB - create or manipulate data of Sequence
written by wfd •Hi there, For my recent GATB project I'd like to either create a Sequence object [with comment(id and such), possibly quality and a given string] …
-
Converting Illumina fastq quality scores to phred
written by L. A. LiggettI have been trying to understand how to calculate probabilities of correct calls in my Illumina dna sequencing results coming off of both the nextseq …
Hello elizaveta.karpovich!
We believe that this post does not fit the main topic of this site.
Zero effort post, lacks context and details. Please edit your question accordingly to qualify it for reopening.
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!