This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What is the reference snp and alternative snp in dbsnp window?

When I searched SNP "rs2976396" in dbsnp and the result is below.

rs2976396 [Homo sapiens]
GTGGACTGAGTAGAACTGGAGGACA[A/G]GAGTCGACGTGAGTTCCTGGGAGTC

Alleles G>A

What is the reference SNP and alternative SNP?

I would like to know how to interpret this.

Thanks advance

snp

1 answer

G is the reference allele and A the alternative allele. G is changed into A, which is represented by G>A. The allele frequences (how often does this particular genotype occur in the studies population) is also indicated on dbSNP.

Thank you for your reply!

Log in to answer this question.