bowtie2 tools and reads targeting
Hi! I need to target some reads on my sequence and then i need to pick up reads from there as fastq. has bowtie2 such tools, or i need some other programms to do?
sequence
gene
assembly
• 1,297 views
•
link
written
by
doramora •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Getting fastq files as the output of bowtie2
written by SaraI am trying to use `bowtie2` to filter out `rRNs` from my `RNAseq` data and as output I would like to get 2 fastq files: …
-
How do I make bwa-mem and bowtie2 less stringent?
written by gt •Hi there, I am trying to detect indels in my E. coli samples from an experiment. I am not able to pick up many indels …
-
How to Align multiple short reads (NGS data) to a short (~200bp) reference?
written by itamar •Hi everyone, As a part of plant genotyping research and CRISPR cas9 mutation screening methods, I need to sequence and align many reads in order …
-
How to read the Fastq files?
written by kristinadobrovolskaa3 •Hello, i need to make my bioinformatic school project. To do this i have to find a mutation in a sequence file. But i don't …
-
group reads by sequence length
written by genya35 •Hello, I have two Illumina fastq files (read 1 and read 2) that contain reads from three different frameworks. Each framework has a different sequence …
-
Looking for a tool like fastq screen but for ONT data
written by RoxHello Biostars! I am currently looking for a tool similar to fastq screen: https://www.bioinformatics.babraham.ac.uk/projects/fastq_screen/fastq_screen_documentation.html, which is able to roughly characterize genome composition (Did we sequenced …
-
Protein modelling with modeller
written by Shamim SarhadiHi I am a newbie in protein modeling, I create a model for my aa sequence with modeller and I-TASSER (zhang lab server), now I …
-
Random extraction of restriction enzyme target sites from whole genome
written by cfarmeriHi Biostars My original fastq reads have restriction enzyme target sequence at the head of each. (e.g. `GGCCTTATATACATCGATCAAGATA......`; **GGCC** is the restriction enzyme target site) …
-
Seed length doesnt match number of aligned reads in SAM file
written by EVRHi, I ran the bowtie2 on a set of fastq reads whose linker sequence have been trimmed. After alignment, I obtained the SAM file. When …
-
How To Delete The All Fastq Reads Which Includes A Potential 50Bp Illumina Single End Pcr Primer 1
written by Tonyzeng •<p>HI, </p> <p>I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings</p> <p>AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA (100% …
so you want to align reads to a certain region and want to output the matching reads again in fastq format?
BBMap will be able to do this easily. (as do other software likely)
ok, thank you! and when it'll save my reads as .sam i should simply use samtools in terminal, or BBMap has some othee tools to save it in fastqc?
BBMap has a gazillion options, likely there is one to output the reads directly in fastqc rather than in sam and then convert them. (most of the time it will look at the file extension to determine the format)