More posts like this
-
Getting fastq files as the output of bowtie2
written by Sara 28I am trying to use `bowtie2` to filter out `rRNs` from my `RNAseq` data and as output I would like to get 2 fastq files: …
-
How to Align multiple short reads (NGS data) to a short (~200bp) reference?
written by itamar 1Hi everyone, As a part of plant genotyping research and CRISPR cas9 mutation screening methods, I need to sequence and align many reads in order …
-
How to read the Fastq files?
written by kristinadobrovolskaa3 0Hello, i need to make my bioinformatic school project. To do this i have to find a mutation in a sequence file. But i don't …
-
centos and bowtie2
written by doramora 1Hi! Have you ever used Centos 7?(or other versions of Centos) I wanted to install bowtie2 on it but it writes an error every time …
-
group reads by sequence length
written by genya35 5Hello, I have two Illumina fastq files (read 1 and read 2) that contain reads from three different frameworks. Each framework has a different sequence …
-
How to align reads on reference using python?
written by doramora 1It may sound quiet easy (for you), so i want to find a bit of help there. How to align reads on reference? I've got …
-
Protein modelling with modeller
written by Shamim Sarhadi 22Hi I am a newbie in protein modeling, I create a model for my aa sequence with modeller and I-TASSER (zhang lab server), now I …
-
Random extraction of restriction enzyme target sites from whole genome
written by cfarmeri 21Hi Biostars My original fastq reads have restriction enzyme target sequence at the head of each. (e.g. `GGCCTTATATACATCGATCAAGATA......`; **GGCC** is the restriction enzyme target site) …
-
Seed length doesnt match number of aligned reads in SAM file
written by EVR 61Hi, I ran the bowtie2 on a set of fastq reads whose linker sequence have been trimmed. After alignment, I obtained the SAM file. When …
-
How To Delete The All Fastq Reads Which Includes A Potential 50Bp Illumina Single End Pcr Primer 1
written by Tonyzeng 32<p>HI, </p> <p>I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings</p> <p>AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA (100% …
so you want to align reads to a certain region and want to output the matching reads again in fastq format?
BBMap will be able to do this easily. (as do other software likely)
ok, thank you! and when it'll save my reads as .sam i should simply use samtools in terminal, or BBMap has some othee tools to save it in fastqc?
BBMap has a gazillion options, likely there is one to output the reads directly in fastqc rather than in sam and then convert them. (most of the time it will look at the file extension to determine the format)