This is a test version of Biostars. For the public version, visit https://www.biostars.org.
EzBioCloud for contamination of Illumina raw files

Hi,

Anybody used ContEst16S: an algorithm that identifies contaminated prokaryotic genomes using 16S RNA gene sequences from EZBiocloud for Illumina files? It gives error when I upload fasta file reads from Illumina. I unzip files and convert them to fasta. It says something went wrong in a webpage error.

rna-seq sequencing
• 5,016 views • link
updated by GenoMax GenoMax • written by eozcan • eozcan

I'd naively assume it expects a fastq file, rather than a fasta file. Can you add a link?

• 1 views • link
written by WouterDeCoster WouterDeCoster

I see, the page clearly says fasta format.

It says something went wrong in a webpage error.

Perhaps you could be a bit more specific here.

• 1 views • link
written by WouterDeCoster WouterDeCoster

I tried to upload a fasta concatenated file from my Illumina pair-end reads, it says "something went wrong displaying the webpage."

• 1 views • link
written by eozcan • eozcan

Can you show us a few lines of your fasta file, and please add the commands you used to make the file.

• 1 views • link
written by WouterDeCoster WouterDeCoster 
>NS500540:135:HFF77AFXY:1:11101:6499:1061 1:N:0:ATTACTCG+NGGATAGG
GGCATTACTTCGGGGTAGGTCTTAAATAAGAGCGCAATGTTGGTATAGGCTCCCGTTGGCACTAACGTAATCGGT
>NS500540:135:HFF77AFXY:1:11101:23445:1062 1:N:0:ATTACTCG+NGGATAGG
CGCGTTTAAAACTTGGGAATGTCTTCGTAACAGACATGCACCTCCGTTTAAACTTTGTAATACCTGAGTCTACAA
>NS500540:135:HFF77AFXY:1:11101:3974:1062 1:N:0:ATTACTCG+NGGATAGG

This is raw illumina reads concatenated using 

cat eo1_S17_L001_R2_001.fastq.gz eo1_S17_L002_R2_001.fastq.gz eo1_S17_L003_R2_001.fastq.gz eo1_S17_L004_R2_001.fastq.gz > eo1_R2.fastq.gz

Then, I used fastxtoool kit to convert from fastq to fasta

• 1 views • link
updated by WouterDeCoster WouterDeCoster • written by eozcan • eozcan

0 answers

No answers yet.

Log in to answer this question.

More posts like this